Información

Problema de ARNm de metaglobina de ratón

Problema de ARNm de metaglobina de ratón


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Esta es una hebra de ARNm de metaglobina de ratón:

5'-ccccagauacggaauucgaau-3 '

A) ¿Qué ARN pequeño (abajo) es más probable que regule la expresión de metaglobina?

  1. 5'-auucgaauuuucuaucugggg-3 '
  2. 5'-ggggucuaucuuuuaagcuua-3 '
  3. 5'-ccccagauacggaauucgaau-3 '
  4. 5'-uaagcuuaaggcauagacccc-3 '

B) ¿Este ARN es más probable?

  1. actúa como un ARNip
  2. inhibir la traducción de metaglobina
  3. aumentar la traducción de metaglobina
  4. ayudar a transportar el ARNm de la metaglobina de regreso al núcleo

Mi intento:

Creo que A es 2 porque la hebra es complementaria y se unirá muy bien a la hebra de ARNm. Para B, estoy entre 2 y 3, pero no puedo decidirme.


Siempre hay excepciones, pero puede considerar algunas reglas generales.

A es 1, es decir, la secuencia que es perfectamente complementaria (2 es complementaria pero la dirección es paralela, no se pueden pares de bases), entonces B sería 1 (siRNA). Razones (algunas se basan simplemente en reglas generales de diseño de ARNip):

  • Los ARNip tienen que ser perfectamente complementarios
  • El tamaño también es perfecto para un ARNip (21nt)
  • U / A (2-3 residuos) en el 5 'del siRNA
  • U en décima posición
  • Contenido de GC 43% (ideal 30-50%)

Consulte aquí las pautas para el diseño de ARNip.


ARNm sintético químicamente modificado (modRNA): hacia una nueva plataforma tecnológica para biología y medicina cardiovascular

Durante las últimas dos décadas, se han descubierto una serie de nuevas vías moleculares que guían el desarrollo y la enfermedad del corazón de los mamíferos. La capacidad de manipular genéticamente estas vías in vivo ha dependido en gran medida de la generación de sistemas de modelos de ratón modificados genéticamente o de la transferencia de genes exógenos en una variedad de vectores de ADN (plásmidos, adenovirales, virus adenoasociados, oligonucleótidos antisentido, etc.) . Recientemente, se ha informado de un nuevo enfoque para manipular el programa genético del corazón de un mamífero adulto que permitirá rápidamente la expresión de alta eficiencia de prácticamente cualquier proteína en el corazón intacto de las células del corazón de ratón, rata, porcino, primate no humano y corazón humano a través de la generación de ARNm químicamente modificado (modARN). La plataforma tecnológica tiene implicaciones importantes para delinear las señales paracrinas específicas que impulsan la cardiogénesis humana y las vías que podrían desencadenar la regeneración del corazón a través de la generación rápida de bibliotecas de modRNA de factores paracrinos para la administración directa in vivo. Además, la estrategia se puede extender a una variedad de otros tejidos cardiovasculares y órganos sólidos en múltiples especies, y las mejoras recientes en la tecnología central han apoyado el avance hacia los primeros estudios en humanos de modRNA en los próximos 2 años. Estos avances recientes se revisan junto con las proyecciones del impacto potencial de la tecnología para una serie de otros problemas biomédicos en el sistema cardiovascular.

Copyright © 2015 Cold Spring Harbor Laboratory Press. Todos los derechos reservados.

Cifras

Enfoques para manipular lo molecular ...

Enfoques para manipular las vías moleculares del corazón humano in vivo. A…

Factor de crecimiento endotelial vascular (VEGF) ...

El modRNA del factor de crecimiento endotelial vascular (VEGF) dirige la expresión de alta eficacia del VEGF secretado de…

VEGFA modRNA dirige un pulso ...

VEGFA modRNA dirige un pulso de expresión del factor paracrino in vivo, ...

( A ) Mesodérmico cardíaco ...

( A ) Los precursores mesodérmicos cardíacos dan lugar a dos subconjuntos distintos de ...


Lane, C. D., Marbaix, G. y Gurdon, J. B. J. molec. Biol. 61, 73–91 (1971).

Hill, M. y Huppert, J. Biochim. biophys. Acta 312, 26–35 (1970).

Furusawa, M., Nishimura, T., Yamaizumi, M. y Okada, Y. Naturaleza 249, 449–450 (1974).

Loyter, A., Zakai, N. y Kulka, R. G. J. Cell Biol. 66, 292–304 (1975).

Maeyer-Guignard, J., Maeyer, E. y Montagnier, L. Proc. natn. Acad. Sci. ESTADOS UNIDOS. 69, 1203–1207 (1972).

Graessmann, A. Expl Cell Res. 60, 373–382 (1970).

Stacey, D. W. y Allfrey, V. G. Celda 9, 725–732 (1976).

Dimitriadis, G. J. FEBS Lett. 86, 289–293 (1978).

Dimitriadis, G. J. Ácidos nucleicos Res. 5, 1381–1386 (1978).

Mayhew, E., Papahadjopoulos, D., O'Malley, J. A., Carter, W. A. ​​y Vail, W. J. Molec. Pharmac. 13, 488–495 (1977).

Papahadjopoulos, D., Vail, W. J., Jacobson, K. y Poste, G. Biochim. biophys. Acta 394, 483–491 (1975).

Weissmann, G. et al. Proc. natn. Acad. Sci. ESTADOS UNIDOS. 72, 88–92 (1975).

Heywood, S. M. Proc. natn. Acad. Sci. ESTADOS UNIDOS. 67, 1782–1788 (1970).

Prichard, P. M., Picciano, D. G., Laycock, D. G. y Anderson, W. F. Proc. natn. Acad. Sci. ESTADOS UNIDOS. 68, 2752–2756 (1971).

Stavnezer, J. y Huang, R. C. C. Nature new Biol. 230, 172 (1971).

Dimitriadis, G. J. y Georgatsos, J. G. FEBS Lett. 46, 96–100 (1974).

Dimitriadis, G. J. y Georgatsos, J. G. Ácidos nucleicos Res. 2, 1719–1726 (1975).

Craig, R. K., Brown, P. A., Harrison, O. S., McIlreavy, D. y Campbell, P. N. Biochem. J. 160, 57–74 (1976).

Laemmli, U. K. Naturaleza 227, 680–685 (1970).

Harris, R. y Ukaejiofo, E. O. Br. J. Haemat. 18, 229–235 (1970).

Avrameas, S. Inmunoquímica 6, 43–52 (1969).

Ternynck, T. y Avrameas, S. FEBS Lett. 23, 24–28 (1972).

Bonner, W. M. y Laskey, R. A. EUR. J. Biochem. 46, 83–88 (1974).


Resultados

El vector de expresión de ADNc antisentido disminuyó los niveles de ARNm de globina en líneas de células MEL estables.

Se establecieron tres líneas de células MEL estables denominadas ES10, ES21 y ES22 utilizando la miniconstrucción HS2γβ. Observamos la expresión constitutiva de los genes de globina γ y β en todas las líneas (Figura 1, carriles 1 y 5) como lo demuestran los ensayos de protección de RNasa (RPA). Los experimentos iniciales para inhibir la expresión de la β-globina se realizaron con dos oligodesoxinucleótidos antisentido (ODN), uno dirigido hacia el sitio de la tapa del gen de la β-globina y el segundo hacia la cola, a diversas concentraciones. No hubo efecto demostrable sobre la expresión del gen β (datos no mostrados). Luego probamos el vector de expresión pZeoβAS, que contiene un fragmento de ADNc de β-globina antisentido bajo el control de un promotor de SV40 para determinar la capacidad de inhibir la expresión de β-globina. Este vector se transfectó en células ES21 para establecer tres líneas estables antisentido. Dada la falta de eficacia de los ODN, decidimos analizar el fragmento de ADNc de β-globina de longitud completa para obtener efectos inhibidores máximos, aunque existe una homología de secuencia del 74% entre los genes γ y β. Observamos una disminución en los niveles de ARNm para la globina β y γ en el día 14 (Figura 1, carriles 2-4) y el día 28 (Figura 1, carriles 6-8) para las tres líneas antisentido. Se analizaron varias otras líneas de control de células MEL estables, incluidas BS211, BS212 y BS213, establecidas con un fragmento de ADNc de β-globina orientado con sentido en células ES21, y la línea de control negativo pZeo, establecida con el vector de expresión pZeoSV original. No hubo cambios significativos en el nivel de ARNm de globina β o γ para las cuatro líneas celulares de control (Figura 1, carriles 9-13). El nivel de transcripción de ARN producido por el vector pZeoβAS se midió usando una sonda de globina β sentido por RPA en diferentes puntos de tiempo. Se detectaron transcripciones de β-globina antisentido hasta el día 42 (datos no mostrados), lo que indica que el promotor de SV40 continuó produciendo transcripciones de ARN antisentido a largo plazo para explicar la expresión del gen de globina suprimida.

Gel protector de ARNasa para las líneas celulares MEL estables con β-globina. Se aisló ARN de las células el día 14 y el día 28 después de las transfecciones. El ARN total (2 µg) se hibridó con sondas específicas para actina de ratón (mActina), β (hβ) humana y γ (hγ) humana (ver Materiales y métodos). La autorradiografía muestra el patrón de expresión de los genes hβ, hγ y mActin en las líneas experimentales: ES21 (control) y las tres líneas celulares estables antisentido ASB211, ASB212 y ASB213 (carriles 1-8). Se analizaron varias líneas estables de control, incluida la ES 10 (carril 9) establecida con el plásmido HS2γβ solo o en combinación con un fragmento de ADNc de globina β orientado con sentido: BS211, BS212 y BS213 (carriles 10-12). Se estableció una línea de control negativo con el plásmido pZeo original (carril 13). Los carriles 14 y 15 contienen controles positivos y negativos (células MEL no transfectadas) para las sondas de ARN utilizadas.

Los niveles de ARNm para la globina β y γ en las tres líneas antisentido se calcularon como una relación frente a la actina de ratón corregida por el número de copias del gen. Para las líneas estables antisentido ASB211, ASB212 y ASB213, el número medio de copias fue 0,18, 0,15 y 0,15, respectivamente, y 0,20 para la línea de control ES21. Los niveles de ARNm de globina β y γ se redujeron en promedio 73,9% y 61,6% (PAG & lt 0.05), respectivamente (Tabla 1 y Figura 2) en las tres líneas antisentido el día 14. El nivel relativo de β versus El ARNm de γ-globina (relación β / γ) disminuyó un 31,8%, lo que indica que la reducción en la síntesis de ARNm de β-globina fue mayor que la del ARNm de γ-globina (Tabla 2). El día 21, la relación β / γ era del 68,1%, lo que indica que desde el día 14 al 21 hubo una reducción más rápida en la producción de ARNm de β-globina que el ARNm de γ-globina. De manera similar, en los días 28 y 35 los niveles de ARNm de la globina β y γ permanecieron bajos, pero la expresión de la globina β se inhibió de manera constante en un grado mayor que la de la globina γ (Tablas 1 y 2). La reducción en la producción de ARNm de globina β y γ por transcritos de ARN antisentido alcanzó niveles aproximadamente iguales de 77% de inhibición el día 42 en cultivo (Tablas 1 y 2 Figura 2). A partir de estos datos, llegamos a la conclusión de que el vector antisentido bloquea la expresión del gen de la globina γ y β, pero hubo un efecto más rápido sobre el gen de la globina β.

Niveles de ARNm de globina humana en las líneas estables antisentido de β-globina. Los niveles de ARNm de globina β (hβ) humana, γ (hγ) humana y actina de ratón (mActina) se analizaron mediante RPA. Los niveles medios de ARNm de globina β y γ para las tres líneas antisentido ASB211, ASB212 y ASB213 se muestran como una relación a mActina corregida para el número de copias del gen en comparación con la línea de control ES21 (el nivel de ARNm se normalizó al 100%). Los valores representan de tres a cuatro experimentos independientes con el error estándar de la media mostrada para el día 14 al día 42.

Disminución de la biosíntesis de la cadena de β-globina en líneas celulares de β-globina MEL antisentido

La proteína total se aisló el día 14 a partir de células MEL no transfectadas y las líneas estables ES21, ASB211 y ASB213. El nivel de biosíntesis de las cadenas de globina β y γ se analizó mediante cromatografía líquida de alta resolución (HPLC) que mostró picos para las cadenas de globina β y γ en la línea ES21 en comparación con las células MEL de control no transfectadas con el plásmido HS2γβ (Figura 3a, b) . Las transfecciones con el vector pZeoβAS dieron como resultado una disminución en el pico de β-globina y un aumento en el pico de γ-globina (Figura 3c). Observamos una disminución del 80% y del 73% en la síntesis de la cadena de globina β humana en las líneas ASB211 y ASB213, respectivamente (Figura 4), sin embargo, la biosíntesis de la cadena de globina γ aumentó un promedio de 233% y 802%, respectivamente, en las dos líneas antisentido. A pesar de la disminución de los niveles de ARNm de γ en el día 14, la biosíntesis de la cadena γ aumentó notablemente. Un posible mecanismo para esta observación es un cambio en la tasa de traducción del ARNm de γ-globina en respuesta a la rápida disminución de los niveles de ARNm de β-globina el día 14 en las líneas antisentido.

Seguimiento de HPLC para la síntesis de cadenas de globina β y γ. La proteína total se aisló el día 14 y las cadenas de globina β (hβ) y γ (hγ) humanas se cuantificaron para el control ES21 (panel b) y la línea antisentido ASB211 (panel c) en comparación con las células MEL no transfectadas de control (panel a). Observe la disminución de las cadenas de globina β y el aumento de la biosíntesis de la cadena de globina γ en la línea antisentido ASB211 (panel c) Mα, cadenas de globina α de ratón mβ comandante , cadenas de globina principal β de ratón.

Síntesis de la cadena de globina en presencia del vector de expresión pZeoβAS. La proteína total se aisló el día 14. Las cadenas de globina β, γ y α (Mα) de ratón humanas se cuantificaron mediante análisis por HPLC. Hubo disminución de la cadena de globina β (hβ) y aumento de la biosíntesis de la cadena de globina γ (hγ) en las líneas celulares ASB211 y ASB213 MEL establecidas con el vector pZeoβAS en comparación con los niveles de la cadena de globina γ y β en ES21. La biosíntesis de la cadena de globina se normalizó al 100% para la línea de control ES21. Los datos representan los valores promedio de dos experimentos independientes para cada línea estable.

Disminución de los niveles de ARNm de globina en cultivos de eritroides primarios

El vector de expresión de globina β antisentido, pZeoβAS, se transfectó en células mononucleares de sangre periférica aisladas de pacientes con células falciformes y normales. Se realizó RPA para cuantificar los niveles de ARNm para los genes de globina γ y β como una proporción de gliceraldehído-3-fosfato deshidrogenasa (GAPD) después de 21 días en cultivo. Observamos un aumento en los ARNm basales de globina β y γ para muestras obtenidas de pacientes con células falciformes en comparación con sujetos normales (Figura 5a, carriles 1 y 3). Esto puede deberse al aumento en la actividad de la médula ósea y al mayor número de células progenitoras tempranas en muestras de células falciformes observado por otros investigadores.21 De manera similar a lo observado en las líneas estables de células MEL antisentido, los niveles de ARNm de globina disminuyeron en progenitores eritroides transfectados con pZeoβAS (Figura 5a, carriles 2 y 4). En comparación con los cultivos de control (progenitores eritroides transfectados con el plásmido pZeoSV original), la producción de ARNm de globina β y γ disminuyó en promedio 83% y 67% (PAG & lt 0,05), respectivamente, para los progenitores eritroides normales y falciformes (Figura 5b, c). Además, la relación de ARNm β / γ disminuyó un 63% para los progenitores normales y un 77% para los progenitores falciformes, lo que indica que la reducción en la síntesis de ARNm de la globina β fue significativamente mayor que la de la globina γ, un resultado similar al observado para las líneas celulares MEL estables. . Además, las transcripciones normales de ARN antisentido de la β-globina producidas por pZeoβAS inhibieron el gen de la β s globina mutante en muestras obtenidas de pacientes con anemia drepanocítica.

Niveles de ARNm de globina en cultivos de eritroides primarios tratados con transcripciones de ARN antisentido. Se transfectaron células mononucleares de sangre periférica con los vectores pZeoβAS o pZeoSV usando un enfoque de lipofección. El vector pZeoSV sirvió como control negativo. NZ, progenitores normales con pZeoSV NA, progenitores normales con pZeoβAS SZ, progenitores falciformes con pZeoSV SA, progenitores falciformes con pZeoβAS. En el panel a se muestra un gel de RPA representativo de una de las cuatro muestras analizadas. Observamos una disminución en la intensidad de la señal de globina β y γ para las muestras de células falciformes y normales (carriles 2 y 4). Los datos cuantitativos de fosforimager se muestran en los paneles by c. Los niveles de ARNm de globina β (hβ) y γ (hγ) se normalizaron al 100% para los experimentos de control con el vector pZeoSV (NZ y SZ). Nótese la disminución más significativa de los niveles de ARNm de la β-globina en comparación con la γ-globina para las muestras de células falciformes y normales.


Discusión

Desarrollamos un método bayesiano llamado DecontX para estimar el porcentaje de contaminación cruzada dentro de cada célula debido al ARN ambiental u otros factores experimentales. En nuestro modelo, cada célula se trata como una mezcla de distribuciones multinomiales sobre genes, una de su población de células nativas y otra de la contaminación. Para cada población de células, la distribución de la contaminación se define como una combinación de recuentos de genes de otras poblaciones de células. Los genes que están más expresados ​​(es decir, tienen más recuentos de UMI) en otras poblaciones de células serán más propensos a contribuir a la contaminación en la población de células actual. Por lo tanto, estos genes tendrán probabilidades relativamente más altas en la distribución de contaminación en comparación con la distribución de expresión en la población de células nativas y es más probable que los recuentos de estos genes se denominen "contaminación". Ciertos tipos de genes de mantenimiento, como los genes que codifican proteínas ribosómicas, pueden expresarse en gran medida en muchas poblaciones de células y, por lo tanto, tendrán altas probabilidades de aparecer tanto en las poblaciones de células nativas como en las distribuciones de contaminación. En este caso, los recuentos de estos genes se denominarán predominantemente "nativos" suponiendo que la proporción total de contaminación estimada en esa célula también sea relativamente baja. Demostramos la precisión de DecontX al demostrar que fue capaz de estimar con precisión el porcentaje de transcripciones contaminantes exógenas en un conjunto de datos de mezcla de ratón y ser humano. Además, después de estimar y eliminar las transcripciones contaminadas en los datos de 4K PBMC, los perfiles de los genes marcadores clave para cada subpoblación se parecían mejor a los de las PBMC clasificadas y purificadas.

Observamos que es más probable que los tipos de células con mayor abundancia y prevalencia de ARNm total dentro del conjunto de datos contribuyan a la contaminación en otros tipos de células. Por ejemplo, en el conjunto de datos de mezcla humano-ratón, las células humanas tenían UMI de alineación más singular en promedio que las células de ratón. Por lo tanto, las células humanas contribuyeron con más lecturas al ARN ambiental y dieron como resultado una mayor contaminación en las células de ratón. En los datos de 4K PBMC, los monocitos fueron el segundo tipo de célula más común y tuvieron el mayor número total de recuentos de UMI en promedio. Además, los genes asociados a monocitos como LYZ, S100A8 y S100A9 fueron los genes marcadores específicos del tipo de célula más expresados ​​y, por lo tanto, contribuyeron más a la contaminación en otros tipos de células en comparación con los marcadores de otras poblaciones. Estos resultados muestran que las distribuciones de contaminación en cada célula dependerán de los otros tipos de células en el ensayo, así como del nivel de expresión de genes específicos en esos tipos de células.

En algunos casos, DecontX no pudo eliminar por completo la expresión aberrante de los marcadores de tipo celular. Por ejemplo, el 43,03% de las células NK en las 4K PBMC todavía presentaban expresión de marcadores de células T. Una posible explicación es que algunas células de este conjunto de datos eran en realidad células NKT y realmente comparten características de expresión de poblaciones de células T y NK [19]. Otro factor es que para las poblaciones de células que comparten similitudes sustanciales en los patrones de expresión génica, DecontX tenderá a ser conservador y tratará la mayoría de estos recuentos como expresión nativa en lugar de contaminación. En general, creemos que este comportamiento es el deseado para que no se elimine la verdadera variación biológica entre los tipos de células. También se estimó que las células altamente contaminadas por DecontX en 4K PBMC eran dobletes por algoritmos independientes. Por lo tanto, los niveles altos de contaminación también pueden ser útiles como criterio de control de calidad para excluir células. Además, la estimación de DecontX en conjuntos de datos de referencia muestra que el cromo 10X tiene la menor contaminación, mientras que CEL-seq2 tiene la mayor contaminación. CEL-seq2 ha mostrado frecuencias mucho más altas de mapeos intrónicos e intergénicos en comparación con otros métodos de scRNA-seq [20]. Aunque el protocolo SORT-seq es similar al CEL-seq2, utilizó aceite de fuga de vapor para evitar la evaporación [7], lo que resultó en menos contaminaciones estimadas en general en nuestro análisis.

Al utilizar recuentos sin procesar para la estimación de las distribuciones multinomiales, DecontX elimina la variabilidad potencial que podría introducirse mediante diferentes métodos de normalización. Una limitación es que las etiquetas de los grupos de células son necesarias a priori. Si bien usamos Celda automáticamente para identificar grupos de células si no se proporciona ninguno, se puede utilizar cualquier enfoque de agrupamiento de células rápido. Como la distribución de la contaminación para cada población celular se deriva de todas las demás poblaciones presentes en el conjunto de datos, a veces puede ser mejor utilizar etiquetas de población celular más amplias. Por ejemplo, incluir todas las células T en un grupo en lugar de tratar la subpoblación de células T individuales como un subgrupo separado puede ayudar a aliviar los recuentos específicos de células T en el cálculo de las distribuciones de contaminación para todas las células T.


Descripción detallada

Los ratones Ai140D albergan el alelo condicional TIGRE-Ins-TRE2-LSL-EGFP-Ins-CAG-LSL-tTA2, diseñado con un promotor TRE2, loxP-Cassette STOP flanqueado y secuencia EGFP, y luego un promotor CAG, lox2272-Cassette STOP flanqueado y secuencia tTA2. Antes de la exposición a la recombinasa Cre, este alelo está diseñado para tener dos casetes floxed-STOP que impiden la expresión de los genes posteriores (EGFP y tTA2). Cuando se cruza con ratones que expresan Cre recombinasa, la descendencia resultante tendrá ambos casetes floxed-STOP eliminados en el cre-expresando células / tejidos - resultando en fluorescencia de EGFP y expresión de ttA2. Debido a su ubicación aguas abajo del promotor TRE2, la introducción posterior de tetraciclina (o su análogo doxiciclina [dox]) disminuirá / eliminará la expresión de EGFP.

Específicamente, el investigador donante informa que en ausencia de Cre, los ratones heterocigotos para Ai140D no exhiben fluorescencia y son viables y fértiles sin anomalías físicas o de comportamiento graves informadas. La inmunotinción anti-GFP revela cierta expresión de fondo en la corteza y el hipocampo, pero esto es varias veces menor que los niveles observados después de la exposición a Cre recombinasa. En septiembre de 2018, según la experiencia del Laboratorio Jackson, los ratones homocigotos son viables y fértiles.
Cuando los ratones Ai140D se crían con líneas Cre-driver para crear animales transgénicos dobles (EGFP + tTA2 + / Cre +), las células que expresan tanto tTA2 como Cre exhiben fluorescencia EGFP robusta / brillante. Se ha caracterizado la atenuación inducible por dox de la expresión de EGFP: la fluorescencia de EGFP se suprime por completo después de dos semanas de tratamiento con dox.
Se han utilizado varias líneas Cre-driver con patrones de expresión específicos con Ai140D, lo que da como resultado una descendencia doble mutante sin problemas de viabilidad (incluidos C57BL / 6J-congénicos Etv1-CreERT2 y Sst-IRES-Cre (véanse los números de serie 013048 y 013044). Sin embargo, los ratones Emx1-IRES-CreAi140D heterocigotos dobles tienen un volumen cerebral reducido y una neurodegeneración pronunciada en todos los subcampos del hipocampo (ver el No. de stock 005628). Además, su experiencia es que los ratones Gad2-CreAi140D doblemente heterocigotos exhibieron letalidad embrionaria (ver el No. de stock 019022). ) - esto es similar a su hallazgo de doble letalidad heterocigótica utilizando el mismo controlador Gad2-Cre con el alelo Ai139D o Ai148D (números de serie 030219 o 030328).

Hasta la fecha (marzo de 2017), el investigador donante no ha evaluado la expresión de Ai140D inducible por Cre en tejidos distintos del cerebro.


La FDA aprueba la primera prueba de CRISPR para corregir el defecto genético que causa la anemia de células falciformes

En 2014, dos años después de su invención ganadora del Premio Nobel de la edición del genoma CRISPR-Cas9, Jennifer Doudna pensó que la tecnología era lo suficientemente madura como para abordar una cura para un trastorno hereditario devastador, la enfermedad de células falciformes, que aflige a millones de personas en todo el mundo. la mayoría de ellos de ascendencia africana. Unas 100.000 personas negras en los EE. UU. Están afectadas por la enfermedad.

Movilizando a colegas en el entonces nuevo Innovative Genome Institute (IGI), una colaboración de investigación conjunta entre la Universidad de California, Berkeley y UC San Francisco, buscaron reparar la mutación única que hace que los glóbulos rojos se deformen y obstruyan las arterias, causando insoportable dolor y, a menudo, muerte. Los tratamientos disponibles en la actualidad generalmente implican transfusiones regulares, aunque los trasplantes de médula ósea pueden curar a quienes pueden encontrar un donante compatible.

Después de seis años de trabajo, ese tratamiento experimental ha sido aprobado para ensayos clínicos por la Administración de Alimentos y Medicamentos de EE. UU., Lo que permite las primeras pruebas en humanos de una terapia basada en CRISPR para corregir directamente la mutación en el gen de la beta-globina responsable de la anemia falciforme. enfermedad celular. La beta-globina es una de las proteínas del complejo de hemoglobina responsable de transportar oxígeno por todo el cuerpo.

Los ensayos, que se espera que duren cuatro años, estarán dirigidos por médicos del UCSF Benioff Children's Hospital Oakland y del Broad Stem Cell Research Center de UCLA, que planean comenzar este verano para inscribir a seis adultos y tres adolescentes con anemia drepanocítica grave.

El laboratorio de diagnóstico clínico del IGI, que se construyó bajo el liderazgo de Doudna para proporcionar pruebas gratuitas de COVID-19 a la comunidad de Berkeley, desempeñará un papel clave en el apoyo analítico para el ensayo mediante el desarrollo de diagnósticos para monitorear el bienestar del paciente y rastrear la eficiencia del tratamiento.

"Estamos motivados para trabajar hacia una cura que pueda ser accesible y asequible para los pacientes de todo el mundo", dijo Doudna, profesor de biología celular y molecular y química de UC Berkeley e investigador del Instituto Médico Howard Hughes. "El lanzamiento de esta prueba es un primer paso esencial en ese camino".

El Dr. Mark Walters, profesor de pediatría en UCSF y director de Jordan Family del Programa de trasplantes de sangre y médula ósea en UCSF Benioff Children's Hospital Oakland, está dirigiendo el ensayo clínico. (Foto cortesía de UCSF)

Otros ensayos han utilizado con éxito CRISPR-Cas9 para anular un gen que suprime el gen de la hemoglobina fetal, que normalmente está desactivado en los seres humanos. Esa técnica vuelve a despertar el gen fetal y, en al menos tres pacientes, ha aliviado los síntomas de la anemia de células falciformes.

El nuevo ensayo es un gen complementario: los investigadores están utilizando CRISPR-Cas9 para reemplazar el gen defectuoso de la beta-globina con una versión reparada, con el objetivo de crear glóbulos rojos adultos normales y curar el trastorno.

"Esta terapia tiene el potencial de transformar la atención de la enfermedad de células falciformes al producir un tratamiento curativo accesible que es más seguro que la terapia actual de trasplante de células madre de un donante de médula ósea", dijo el Dr. Mark Walters, profesor de pediatría en UCSF y investigador principal del proyecto de ensayo clínico y edición de genes. "Si esto se aplica con éxito en pacientes jóvenes, tiene el potencial de prevenir complicaciones irreversibles de la enfermedad".

Otro ensayo clínico que también usa CRISPR para corregir directamente la mutación de células falciformes, pero con un enfoque ligeramente diferente, está planeado para comenzar este año, dirigido por Graphite Bio basado en una investigación del laboratorio Matthew Porteus & # 8217 en la Universidad de Stanford.

Los pacientes son sus propios donantes de células madre

La técnica, al igual que el método alternativo que despierta la hemoglobina fetal, requiere que algunas de las células madre hematopoyéticas del paciente, las células de la médula ósea que generan todos los glóbulos rojos del cuerpo, se recolecten para la edición de genes fuera del cuerpo. Una vez que se extraen estas células, la médula ósea restante se destruye con quimioterapia para dejar espacio para que crezcan las células madre reparadas y reinfundidas.

El Dr. Donald Kohn, profesor distinguido de microbiología, inmunología y genética molecular, pediatría y farmacología molecular y médica en la Facultad de Medicina David Geffen de UCLA y miembro del Centro de Investigación de Células Madre Amplias de UCLA, participa en varios ensayos de terapia génica. para enfermedades como la SCID y la anemia de células falciformes. (Foto cortesía de UCLA)

Walters, quien también es el Director de la Familia Jordan del Programa de Trasplante de Sangre y Médula Ósea en UCSF Benioff Children's Hospital Oakland, trabajará con el médico y científico de UCLA Dr. Donald Kohn, quien ha desarrollado terapias genéticas para varios trastornos genéticos de la sangre, incluida una cura. para una forma de inmunodeficiencia combinada grave (SCID). Kohn también está dirigiendo un ensayo clínico de un tipo diferente de terapia génica para la anemia de células falciformes, que implica agregar un nuevo gen a las células madre de los pacientes para superar la mutación de las células falciformes.

"La terapia genética y la edición de genes permiten que cada paciente sirva como su propio donante de células madre", dijo Kohn, profesor distinguido de microbiología, inmunología y genética molecular, pediatría y farmacología molecular y médica en la Facultad de Medicina David Geffen de UCLA y miembro del Centro de Investigación de Células Madre Amplias de UCLA. "En teoría, estos enfoques deberían ser mucho más seguros que un trasplante de otra persona y podrían estar disponibles universalmente porque eliminan la necesidad de encontrar la aguja en un pajar que sea un donante de células madre compatible".

Kohn dirigirá las actividades de laboratorio y ensayos clínicos en UCLA y supervisará toda la fabricación del producto farmacéutico, llamado CRISPR_SCD001, para el ensayo clínico. El trabajo preclínico para desarrollar esta terapia fue financiado por el Instituto de Medicina Regenerativa de California, la Iniciativa de Cura de Células Falciformes, dirigida por el Instituto Nacional del Corazón, los Pulmones y la Sangre, y la Fundación Caritativa Doris Duke.

Fyodor Urnov, director de tecnología y traducción del IGI y profesor de biología celular y molecular de UC Berkeley, supervisará las actividades de bioinformática y genómica para el estudio.

“Es de destacar que este nuevo ensayo proviene de un consorcio de instituciones académicas sin fines de lucro incentivadas con una visión a largo plazo para curar la enfermedad con una solución asequible que pueda beneficiar globalmente a todos los que la necesiten”, dijo Urnov.

Fyodor Urnov, director de tecnología y traducción del IGI, supervisará las actividades de bioinformática y genómica para el ensayo clínico. (Foto de Keegan Houser)

La anemia de células falciformes es causada por un solo cambio en el código de ADN del gen de la beta-globina. El nuevo ensayo utiliza la nucleasa CRISPR-Cas9, una proteína Cas9 completamente ensamblada y una secuencia de ARN guía dirigida a la región defectuosa del gen de la beta-globina, acompañada de un segmento corto de ADN que codifica la secuencia adecuada, para estimular la reparación de la mutación falciforme sustituyendo el segmento de ADN normal para el anormal. En este enfoque, las células madre sanguíneas del paciente se tratan primero con pulsos eléctricos que crean poros en sus membranas. Estos poros permiten que la plataforma CRISPR-Cas9 ingrese a las células madre y viaje a sus núcleos para corregir la mutación de las células falciformes.

“El objetivo de esta forma de terapia de edición del genoma es corregir la mutación en suficientes células madre para que la sangre resultante en circulación haya corregido los glóbulos rojos”, dijo Walters. "Basándonos en nuestra experiencia con los trasplantes de médula ósea, predecimos que corregir el 20% de los genes debería ser suficiente para competir con las células falciformes nativas y tener un gran beneficio clínico".

El protocolo de fabricación final utiliza un método libre de virus para editar las células madre sanguíneas y ha sido validado en estudios preclínicos de seguridad / toxicología realizados después de consultar con la FDA.

Futuras terapias CRISPR

Mientras que los médicos de la UC llevan la terapia CRISPR actual a ensayos clínicos, los científicos de IGI están trabajando para mejorar la técnica de modo que, eventualmente, la corrección de la mutación de las células falciformes se pueda realizar dentro del cuerpo, sin eliminar las células madre ni destruir la médula ósea. Debido a que la médula ósea también produce glóbulos blancos que nos protegen de las enfermedades, su destrucción debilita el sistema inmunológico y pone a los pacientes en mayor riesgo de infección o incluso de cáncer hasta que las células madre corregidas e infundidas puedan multiplicarse y reponerse.

La anemia de células falciformes es causada por una mutación en el gen de la beta-globina que hace que los glóbulos rojos se deformen en forma de hoz (primer plano) en comparación con la forma circular normal que se ve al fondo. Las células falciformes obstruyen las arterias, lo que provoca un dolor intenso y daño a los órganos. (Imagen cortesía del Innovative Genomics Institute, UC Berkeley)

& # 8220Actualmente, estamos haciendo una terapia ex vivo, en la que se extraen células de la médula ósea para corregir la mutación fuera del cuerpo & # 8221, dijo Ross Wilson, director de administración terapéutica de IGI & # 8217. & # 8220Pero durante este tiempo, podrían pasar meses, la médula ósea se está llenando de nuevo. Como resultado, cuando llega el momento de infundir las células corregidas, el paciente debe ser sometido a una quimioterapia agresiva que limpia la médula ósea y permite que esas células corregidas encuentren un hogar. & # 8221

Wilson es optimista de que él y los científicos de IGI pueden encontrar una manera de enviar la terapia CRISPR directamente a la médula ósea dentro del cuerpo, utilizando anticuerpos para dirigir la enzima CRISPR a las células madre correctas. Otros científicos, que utilizan virus modificados genéticamente o gotitas de grasa (nanopartículas de lípidos) para transportar la enzima CRISPR al cuerpo, han fracasado hasta ahora.

& # 8220La molécula que estamos tratando de administrar es físicamente más pequeña, un octavo del diámetro de las nanopartículas que otras personas intentan administrar a la médula ósea, y esto podría proporcionar grandes beneficios & # 8221, dijo. “Our self-delivering enzyme should be able to reach the bone marrow.”

Graphic representation of CRISPR-Cas9 repairing the mutation in the gene that causes sickle cell disease (shown in light blue). (UC Berkeley image courtesy of Innovative Genomics Institute)

Whatever the successful strategy, either ex vivo or in vivo, the CRISPR platform developed for sickle cell disease could transform gene therapy for other diseases.

“That is the IGI vision: first sickle cell, but our efforts will have a ripple effect to enable cures for blood disorders in general, like beta thalassemia, as well as diseases of the immune system,” he said. “The hematopoietic stem cell is the seed for the entire immune system, so all blood disorders can theoretically be cured by a stem cell therapy like this.”


Fondo

The domain of chicken beta-globin genes is located on chromosome 1 and has a length of approximately 33 kb. It includes a cluster of four beta-globin genes: ρ (HBG1), β H (HBE1), β A (HBG2) y Ε (HBE) and several distant regulatory regions, which are marked with sites of hypersensitivity to DNase I (HS) and are necessary for the regulation of transcription, replication and chromatin status of the domain[1, 2]. The locus control region of the domain (LCR) is located upstream of the embryonic β-globin gene ρ and is composed of three blocks co-localizing with the erythroid cell-specific HSs 1 to 3[3, 4]. A constitutive HS4 located upstream of the LCR marks the position of the well-studied CTCF-dependent (CTCF ‐ СССTC-binding protein factor) insulator[5–9]. The CTCF-dependent enhancer-blocking element is also located at the downstream end of the domain in the area marked by the so-called 3′ constitutive HS[10, 11]. In addition to the LCR, the domain also possesses an internal enhancer (β/Ε-enhancer), which is located between the genes β A y Ε and is believed to contribute to the control of the activity of both genes[12–14]. The partitioning of tasks between the LCR and the β/Ε-enhancer is not quite clear. The results of experiments with transgenic mice carrying the chicken β-globin gene domain[4] suggested that the expression of one of the embryonic genes (ρ) is controlled by the LCR, while the expression of the other embryonic gene (Ε) is controlled by the β/Ε-enhancer. In addition, both regulatory elements appeared to be necessary for the correct developmental expression of the adult β-globin genes[3]. The domain of the chicken β-globin gene represents one of the best-studied genomic areas in higher eukaryotes[15]. This domain possesses all of the characteristic features of the so-called closed or strong chromatin domains[16, 17], which change the pattern of sensitivity to DNase I in a cell lineage-specific fashion. Detailed studies of the distribution of different histone modifications along the domain have contributed much to the present knowledge about the histone code[18, 19]. Nevertheless, the mechanisms of transcriptional switching of chicken β-globin gene expression remain poorly understood[15]. The developmental switching of globin gene transcription is typical for all vertebrate organisms[2]. In chickens, the first molecules of hemaglobin appear in embryonic erythroblasts 32 h after fertilization[20]. The beta-chains of the hemaglobin represent the products of genes ρ y Ε, which are transcribed from the 2 nd to the 5 th day of the embryonic development. After the 5 th day a new population of erythroid cells expressing the genes of fetal and adult globins β Н y β A appears. These cells gradually replace the embryonic-type erythroblasts that express genes 1ρ y Ε[21]. In erythroblasts of adult lineage, the transcription of embryonic β-type globin genes is repressed.

Analysis of β-globin mRNA levels in chicken 3-day and 9-day embryonic red blood cells. The vertical axis shows the relative amounts of β-globin gene primary transcripts, as determined by RT-qPCR analysis of RNA samples prepared from the blood of 3- and 9-day old chicken embryos. (A) Normalization of data to the level of β-actin mRNA. (B) Normalization of data to the amount of cells used for RNA preparation. The amounts of β-globin gene transcripts detected in different RNA samples were normalized to the number of cells used for preparation of these RNA samples. The amount of the most abundant transcript (ρ-transcript in 3-day RBCs) was set as 100 relative units and the other data were normalized to this value. The error bars represent the S.E.M. for two independent experiments.

Recent studies of the spatial configuration of the mouse and human β-globin gene domain suggest that in erythroid cells, all regulatory elements of the domain become assembled into a common activation complex (the ACH) where the promoters of different globin genes are recruited in a developmental stage-specific fashion[22–24].

In the present work, we have analyzed the spatial configuration of the chicken β-globin gene domain in circulating red blood cells (RBCs) both before (3-day RBCs) and after (9-day RBCs) the β-globin switching. Using the quantitative chromosome conformation capture assay (3C-qPCR)[25, 26], we have demonstrated that the switching of chicken β-globin gene expression correlates with prominent changes in the spatial configuration of the domain. However, the observed spectrum of changes does not perfectly fit the simplistic model that postulates that only the transcriptionally active genes are recruited to the ACH.


Materiales y métodos

Production of ivt mRNA

PCR DNA fragments with a modified T7 promoter sequence (TAA TAC GAC TCA CTA TAA GG) and an eiF4G aptamer (ACT CAC TAT TTG TTT TCG CGC CCA GTT GCA AAA AGT GTC G) followed by a codon- optimized firefly luciferase-coding gene (a synthetic gene purchased from Blue Heron Bio) or ZsGreen gene (Clontech) and terminated by either the sequence TAA or 5’ GAGAGCTCGCTTTCTTGCTG 3’ or a tandem repeat of the beta-globin 3’ UTR 14 were used as matrices for mRNA production with a HiScribe™ T7 mRNA Kit (New England Biolabs). The nucleotide mixture consisted of 8 mM CleanCapTM (a newly available CAP1 analogue), ATP, GTP, either CTP or 5mCTP and either UTP or N1-methyl pseudouridine (1) triphosphate (all from TriLink) at a final volume of 20 microlitres.

After incubation for 3 hours at 37°C, 80 microlitres of a solution containing 10 microlitres of 10x buffer, 3 microlitres of poly (A) polymerase, 1 microlitre of DNase and 1 microlitre of RNasin (all from New England Biolabs) were added. The reaction was incubated for 3 hours before the addition of 50 microlitres of 8M LiCl, cooling at -20°C for 30 minutes and centrifugation at 15000 rpm for 15 minutes. Supernatants were removed, and 200 microlitres of 75% ethanol was added. After a 10 minute centrifugation at 15000 rpm, the supernatants were discarded, and the RNA pellets were dried in a “Speed-Vac”. RNAs were then resuspended in water, and the concentration measured using a Nanodrop was adjusted to 1 microgram per microlitre. Quality and integrity of ivt mRNAs were checked using agarose gel electrophoresis. The RNAs were stored at -20°C.

Cells and Transfection

Human embryonic kidney (HEK) cells and CT26 mouse colon carcinoma cells were maintained in RPMI medium (Thermo Fisher Scientific) containing 10% foetal calf serum (FCS) and 0.2% antimicrobial reagent Normocin (InvivoGen). Human peripheral mononuclear blood cells (PBMCs) and mouse splenocytes were obtained from peripheral blood from healthy donors and wild type C57Bl/6 or BALB/c mice, respectively, using centrifugation with Ficoll. For Luciferase experiments, transfection of tumour cells (CT26 or HEK) was performed with 100 000 tumour cells per well in 100 microlitres of RPMI medium supplemented with 10% FCS and 0.2% antimicrobial reagent Normocin (Invivogen) by adding a mixture of 20 ng of mRNA in 0.5 microlitres of Opti- MEM (Thermo Fisher Scientific) and 40 ng of the lipofectamine transfection reagent MessengerMAX (Thermo Fisher Scientific) in 0.5 microlitres of Opti-MEM to each well.

Transfection of non-transformed cells (PBMCs or splenocytes) was performed with 1 million cells per well in 100 microlitres of RPMI medium supplemented with 10% FCS and 0.2% antimicrobial reagent Normocin (Invivogen) by adding a mixture of 200 ng of mRNA in 5 microlitres of Opti-MEM and 400 ng of MessengerMAX in 5 microlitres of Opti-MEM to each well. Luciferase activity was recorded one day after transfection by adding 25 microlitres of Bright-Glo luciferase assay solution (Promega) and measuring activity using GloMax luminometer equipment (Promega). For ZsGreen experiments, transfection of tumour cells (CT26 or HEK) was performed with 100 000 tumour cells per well in 200 microlitres of RPMI medium supplemented with 10% FCS and 0.2% antimicrobial reagent Normocin (Invivogen) by adding a mixture of 100 ng of mRNA in 2.5 microlitres of Opti-MEM (Thermo Fisher Scientific) and 200 ng of the lipofectamine transfection reagent MessengerMAX (Thermo Fisher Scientific) in 2.5 microlitres of Opti-MEM to each well. Fluorescence (Excitation: 485nm Emission: 528nm) was recorded in real time at 37°C using Cytation™ 3 Cell Imaging Multi-Mode Reader (BioTek). Immunostimulation experiments were performed by forming protamine-RNA nanoparticles as previously described 15 (mixing RNA at 0.5 mg/ ml in water with protamine at 0.5 mg/ml in water) and incubating them with PBMCs for 20 hours at a final RNA concentration of 5 microgram/ml. Then, the interferon-alpha and tumour necrosis factor (TNF)-alpha contents in the cell culture supernatants were recorded using ELISAs (from Mabtech and eBioscience, respectively).

Animals and en vivo Imaging

Our study “Anti-cancer therapies based on RNA” was approved by the Veterinary Office of the University of Zurich (Kanton Zürich, Health Direction, Veterinary Office, Zollstrasse 20 8090 Zurich license number ZH215/17). The Veterinary Office of the University of Zurich has a research ethics review committee that granted approval. All efforts were made to minimize suffering. Animals were purchased from Envigo (Netherlands). Mice of 4 to 8 weeks of age were injected intra-venously with 1 microgram of mRNA formulated with a TransIT-mRNA transfection kit following the manufacturer’s suggestions (Mirus). Briefly, per mouse, 1 microgram of mRNA was diluted in 38 microlitres of Opti-MEM (Gibco) before the addition of 0.72 microlitres of “mRNA Boost Reagent”. After mixing, 1.12 microlitres of TransIT reagent was added. The solution was thoroughly homogenated and injected immediately. Five hours later, bioluminescence en vivo imaging was performed on an IVIS Lumina instrument (PerkinElmer). Immediately before the measurements, D-luciferin (Synchem) dissolved in PBS (15 mg/ml stock) and sterile filtered was injected (150 μg/g intraperitoneally). Emitted photons from live animals were quantified 10-20 minutes post luciferin injections, with an exposure time of 1 min. Regions of interest (ROI) were quantified for average radiance (photons s−1 cm−2 sr−1) (IVIS Living Image 3.2).


Referencias

1. Vinjamur DS, Bauer DE, Orkin SH. Recent progress in understanding and manipulating haemoglobin switching for theopathies. Br J Haematol. (2018) 180:630�. doi: 10.1111/bjh.15038

2. Wienert B, Martyn GE, Funnell APW, Quinlan KGR, Crossley M. Wake-up sleepy gene: reactivating fetal globin for β-hemoglobinopathies. Trends Genet. (2018) 34:927�. doi: 10.1016/j.tig.2018.09.004

3. Steinberg MH, Rodgers GP. HbA2: biology, clinical relevance and a possible target for ameliorating sickle cell disease. Br J Haematol. (2015) 170:781𠄷. doi: 10.1111/bjh.13570

4. Manchinu MF, Marongiu MF, Poddie D, Casu C, Latini V, Simbula M, et al. En vivo activation of the human δ-globin gene: the therapeutic potential in β-thalassemic mice. Haematologica. (2014) 99:76�. doi: 10.3324/haematol.2012.082768

5. Danjou F, Zoledziewska M, Sidore C, Steri M, Busonero F, Maschio A, et al. Genome-wide association analyses based on whole-genome sequencing in Sardinia provide insights into regulation of hemoglobin levels. Nat Genet. (2015) 47:1264�. doi: 10.1038/ng.3307

6. Borg J, Papadopoulos P, Georgitsi M, Gutiérrez L, Grech G, Fanis P, et al. Haploinsufficiency for the erythroid transcription factor KLF1 causes hereditary persistence of fetal hemoglobin. Nat Genet. (2010) 42:801𠄵. doi: 10.1038/ng.630

7. Tallack MR, Perkins AC. Three fingers on the switch: krüppel-like factor 1 regulation of γ-globin to β-globin gene switching. Curr Opin Hematol. (2013) 20:193�. doi: 10.1097/MOH.0b013e32835f59ba

8. Wienert B, Martyn GE, Kurita R, Nakamura Y, Quinlan KGR, Crossley M. KLF1 drives the expression of fetal hemoglobin in British HPFH. Sangre. (2017) 130:803𠄷. doi: 10.1182/blood-2017-02-767400

9. Perseu L, Satta S, Moi P, Demartis FR, Manunza L, Sollaino MC, et al. KLF1 gene mutations cause borderline HbA(2). Sangre. (2011) 118:4454𠄸. doi: 10.1182/blood-2011-04-345736

10. Porcu S, Manchinu MF, Marongiu MF, Sogos V, Poddie D, Asunis I, et al. Klf1 affects DNase II-alpha expression in the central macrophage of a fetal liver erythroblastic island: a non-cell-autonomous role in definitive erythropoiesis. Mol Cell Biol. (2011) 31:4144�. doi: 10.1128/MCB.05532-11

11. Keyel PA. Dnases in health and disease. Dev Biol. (2017) 429:1�. doi: 10.1016/j.ydbio.2017.06.028

12. Yoshida H, Okabe Y, Kawane K, Fukuyama H, Nagata S. Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA. Nat Immunol. (2005) 6:49�.

13. Strouboulis J, Dillon N, Grosveld F. Developmental regulation of a complete 70-kb human beta-globin locus in transgenic mice. Genes Dev. (1992) 6:1857�. doi: 10.1101/gad.6.10.1857

14. Weatherall DJ. The inherited diseases of hemoglobin are an emerging global health burden. Sangre. (2010) 115:4331𠄶. doi: 10.1182/blood-2010-01-251348

15. Thompson AA, Walters MC, Kwiatkowski J, Rasko JEJ, Ribeil JA, Hongeng S, et al. Gene therapy in patients with transfusion-dependent β-thalassemia. N Engl J Med. (2018) 378:1479�. doi: 10.1056/NEJMoa1705342

16. Cavazzana M, Mavilio F. Gene therapy for hemoglobinopathies. Hum Gene Ther. (2018) 29:1106�. doi: 10.1089/hum.2018.122

17. Modell B, Darlison M. Global epidemiology of haemoglobin disorders and derived services indicators. Bull World Health Organ. (2008) 86:480𠄷. doi: 10.2471/blt.06.036673

18. Piel FB, Hay SI, Gupta S, Weatherall DJ, Williams TN. Global burden of sickle cell anaemia in children under five, 2010-2050: modelling based on demographics, excess mortality, and interventions. PLoS Med. (2013) 10:e1001484. doi: 10.1371/journal.pmed.1001484

19. Origa R. β-Thalassemia. Genet Med. (2017) 19:609�. doi: 10.1038/gim.2016.173

20. Fibach E, Manor D, Oppenheim A, Rachmilewitz EA. Proliferation and maturation of human erythroid progenitors in liquid culture. Sangre. (1989) 73:100𠄳.

21. Pope SH, Fibach E, Sun J, Chin K, Rodgers GP. Two-phase liquid culture system models normal human adult erythropoiesis at the molecular level. Eur J Haematol. (2000) 64:292�. doi: 10.1034/j.16000609.2000.90032.x

22. Menzel S, Garner C, Rooks H, Spector TD, Thein SL. HbA2 Levels in normal adults are influenced by two distinct mechanisms. Br J Haematol. (2013) 160:101𠄵. doi: 10.1111/bjh.12084

23. Socolovsky M, Murrell M, Liu Y, Pop R, Porpiglia E, Levchenko A. Negative autoregulation by FAS mediates robust fetal erythropoiesis. PLoS Biol. (2007) 5:e252. doi: 10.1371/journal.pbio.0050252

24. Ribeil JA, Arlet JB, Dussiot M, Moura IC, Courtois G, Hermine O. Ineffective erythropoiesis in β-thalassemia. Sci World J. (2013) 2013:394295. doi: 10.1155/2013/394295

25. Gupta R, Musallam KM, Taher AT, Rivella S. Ineffective erythropoiesis: anemia and iron overload. Hematol Oncol Clin North Am. (2018) 32:213�. doi: 10.1016/j.hoc.2017.11.009

26. Ozcan ME, Ince B, Karadeli HH, Gedikbasi A, Asil T, Altinoz MA. Higher minor hemoglobin A2 levels in multiple sclerosis patients correlate with lesser disease severity. Neuropsychiatr Dis Treat. (2016) 1612:2033𠄸. doi: 10.2147/NDT.S109954

27. Palstra RJ, de Laat W, Grosveld F. Beta-globin regulation and long-range interactions. Adv Genet. (2008) 61:107�. doi: 10.1016/S0065-2660(07)00004-1

28. Ross J, Pizarro A. Human beta and delta globin messenger rnas turn over at different rates. J Mol Biol. (1983) 167:607�.

29. Runkel L, Meier W, Pepinsky RB, Karpusas M, Whitty A, Kimball K, et al. Structural and functional differences between glycosylated and non-glycosylated forms of human interferon-beta (IFN-beta). Pharm Res. (1998) 15:641𠄹.

30. Durelli L, Verdun E, Barbero P, Bergui M, Versino E, Ghezzi A, et al. Every-other-day interferon beta-1b versus once-weekly interferon beta-1a for multiple sclerosis: results of a 2-year prospective randomised multicentre study (INCOMIN). Lanceta. (2002) 359:1453�. doi: 10.1016/s0140-6736(02)08430-1

31. Rodero MP, Tesser A, Bartok E, Rice GI, Della Mina E, Depp M, et al. Type I interferon-mediated autoinflammation due to DNase II deficiency. Nat Commun. (2017) 8:2176. doi: 10.1038/s41467-017-01932-3

32. Paikari A, Sheehan VA. Fetal haemoglobin induction in sickle cell disease. Br J Haematol. (2018) 180:189�. doi: 10.1111/bjh.15021

33. Ristaldi MS, Casula S, Porcu S, Marongiu MF, Pirastu M, Cao A. Activation of the delta-globin gene by the beta-globin gene CACCC motif. Blood Cells Mol Dis. (1999) 25:193�.

34. Powars DR, Weiss JN, Chan LS, Schroeder WA. Is there a threshold level of fetal hemoglobin that ameliorates morbidity in sickle cell anemia?. Sangre. (1984) 63:921𠄶.

35. Estepp JH, Smeltzer MP, Kang G, Mstats CL, Wang WC, Abrams C, et al. A clinically meaningful fetal hemoglobin threshold for children with sickle cell anemia during hydroxyurea therapy. Am J Hematol. (2017) 92:1333𠄹. doi: 10.1002/ajh.24906

36. Testa U. Apoptotic mechanisms in the control of erythropoiesis. Leukemia. (2004) 18:1176-99. doi: 10.1038/sj.leu.2403383

37. Sarvothaman S, Undi RB, Pasupuleti SR, Gutti U, Gutti RK. Apoptosis: role in myeloid cell development. Blood Res. (2015) 50:73𠄹. doi: 10.5045/br.2015.50.2.73

38. Manchinu MF, Brancia C, Caria CA, Musu E, Porcu S, Simbula M, et al. Deficiency in interferon type 1 receptor improves definitive erythropoiesis in Klf1 null mice. Cell Death Differ. (2018) 25:589�. doi: 10.1038/s41418-017-0003-5

39. Means RT Jr, Krantz SB. Inhibition of human erythroid colony-forming units by tumor necrosis factor requires beta interferon. J Clin Invest. (1993) 91:416𠄹.

40. Means RT Jr, Krantz SB. Inhibition of human erythroid colony-forming units by interferons alpha and beta: differing mechanisms despite shared receptor. Exp Hematol. (1996) 24:204𠄸.

41. Sankaran VG, Ludwig LS, Sicinska E, Xu J, Bauer DE, Eng JC, et al. Cyclin D3 coordinates the cell cycle during differentiation to regulate erythrocyte size and number. Genes Dev. (2012) 26:2075�. doi: 10.1101/gad.197020

Keywords: erythropoiesis, δ-globina gene, interferon type 1, beta thalassemia, sickle cell anemia

Citation: Manchinu MF, Simbula M, Caria CA, Musu E, Perseu L, Porcu S, Steri M, Poddie D, Frau J, Cocco E, Manunza L, Barella S and Ristaldi MS (2020) Delta-Globin Gene Expression Is Enhanced en vivo by Interferon Type I. Parte delantera. Medicina. 7:163. doi: 10.3389/fmed.2020.00163

Received: 28 January 2020 Accepted: 09 April 2020
Published: 22 May 2020.

Richard Van Wijk, Utrecht University, Netherlands

Cornelis Harteveld, Leiden University Medical Center, Netherlands
Emile Van Den Akker, Sanquin Diagnostic Services, Netherlands

Copyright © 2020 Manchinu, Simbula, Caria, Musu, Perseu, Porcu, Steri, Poddie, Frau, Cocco, Manunza, Barella and Ristaldi. Este es un artículo de acceso abierto distribuido bajo los términos de la Licencia de atribución Creative Commons (CC BY). Se permite el uso, distribución o reproducción en otros foros, siempre que se acredite al autor (es) original (es) y al propietario (es) de los derechos de autor y se cite la publicación original en esta revista, de acuerdo con la práctica académica aceptada. No se permite ningún uso, distribución o reproducción que no cumpla con estos términos.



Comentarios:

  1. Jysen

    Pido disculpas, pero, en mi opinión, no tienes razón. Estoy seguro. Escríbeme en PM, hablaremos.

  2. Iseabail

    Está de acuerdo contigo

  3. Nenris

    Eliminar todo, que un tema no se preocupa.

  4. Telen

    Tu !!!! Hemos ganado :)

  5. Arashisar

    Es una pena, que ahora no puedo expresar: llego tarde a una reunión. Volveré, necesariamente expresaré la opinión.



Escribe un mensaje