Información

¿Puede un reservorio hospedador actuar como vector?

¿Puede un reservorio hospedador actuar como vector?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

¿Es posible contraer una infección por contacto con un huésped reservorio?

¿Puede un reservorio hospedador actuar como vector?

¿Cuál es la distinción entre estos dos conceptos (anfitrión del reservorio vs vector) ?


Un huésped reservorio es más obviamente un organismo portador a largo plazo de un patógeno dado que no presenta la enfermedad causada por el patógeno.

Un vector es literalmente cualquier agente que transfiere el patógeno a otro organismo. Si lo piensa bien, un reservorio no tiene que ser un vector, es decir, no hay una ruta de transmisión en la que participen, pero un vector ciertamente puede ser un reservorio, como los murciélagos, que a menudo actúan como vector para los patógenos que albergan. (piense en la rabia). Por otro lado, las garrapatas son vectores comunes de la enfermedad de Lyme, pero los pequeños roedores en realidad actúan como reservorios de B. burgdorferi (1).


¿Puede un reservorio hospedador actuar como vector? - biología

TIPOS DE ANFITRIONES

Los anfitriones son los animales que albergan parásitos. Son más grandes que los parásitos en tamaño. Los diferentes tipos de hosts son,

1. ANFITRIÓN PRIMARIO: Es el huésped que alberga la etapa adulta o etapa de madurez sexual de un parásito o el huésped en el que el parásito se reproduce sexualmente.

p.ej., Hombre es el anfitrión principal para Wuchereria bancrofti,

Anofeles femeninos el mosquito es el hospedador principal de Plasmdium vivax.

2. ANFITRIÓN SECUNDARIO: Es el hospedador que alberga las etapas larvarias en desarrollo o inmaduras o asexuales de un parásito o el hospedador en el que el parásito experimenta una reproducción asexual.

p.ej, Hombre es el anfitrión secundario para plasmodium vivax,

Culex femenino el mosquito es el huésped secundario para Wuchereria bancrofti.

ANFITRIÓN DEL RESERVORIO: Es el huésped el que aloja las etapas infecciosas de un parásito en su cuerpo cuando el huésped principal no está disponible. En el huésped reservorio, el parásito no se desarrolla ni causa ninguna enfermedad.

p.ej., Mono por plasmodio,

Antílope africano por Tripanosoma juego, etc.,

4.VECTOR: El vector es un organismo que transfiere las etapas infecciosas de un parásito de un huésped principal a otro.

Los vectores son de dos tipos, a saber

A) VECTOR MECANICO: Es el vector, que simplemente transfiere las etapas infecciosas de un parásito pero no tiene lugar en él ninguna parte del desarrollo parasitario.

p.ej., Moscas domésticas y Cucarachas En el caso de Entamoeba.

B) VECTOR BIOLÓGICO: Es el vector en el que el parásito sufre una parte del desarrollo antes de ser transferido a otro hospedador.


Contenido

La gran diversidad de patógenos infecciosos, sus posibles huéspedes y las formas en que sus huéspedes responden a la infección ha dado lugar a múltiples definiciones de "reservorio natural", muchas de las cuales son conflictivas o incompletas. En una exploración conceptual de 2002 publicada en los CDC Enfermedades infecciosas emergentes, el reservorio natural de un patógeno dado se define como "una o más poblaciones o entornos conectados epidemiológicamente en los que el patógeno puede mantenerse permanentemente y desde el cual se transmite la infección a la población objetivo definida". [2] El población objetivo es la población o especie en la que el patógeno causa la enfermedad es la población de interés porque sufre una enfermedad cuando se infecta por el patógeno (por ejemplo, los seres humanos son la población objetivo en la mayoría de los estudios epidemiológicos médicos). [3]

Un criterio común en otras definiciones distingue a los reservorios de los no reservorios por el grado en que el hospedador infectado muestra síntomas de enfermedad. Según estas definiciones, un reservorio es un huésped que no experimenta los síntomas de la enfermedad cuando está infectado por el patógeno, mientras que los no reservorios muestran síntomas de la enfermedad. [4] El patógeno todavía se alimenta, crece y se reproduce dentro de un huésped reservorio, pero por lo demás no afecta significativamente su salud, la relación entre el patógeno y el reservorio es más o menos comensal, mientras que en los huéspedes susceptibles que padecen la enfermedad causada por el patógeno, el patógeno se considera parasitario.

Lo que además define un reservorio para un patógeno específico es dónde se puede mantener y desde dónde se puede transmitir. Un organismo "multi-hospedante" es capaz de tener más de un reservorio natural.

Los reservorios naturales se pueden dividir en tres tipos principales: humanos, animales (no humanos) y ambientales. [1]

Reservorios humanos Editar

Reservorios humanos son seres humanos infectados por patógenos que existen en o dentro del cuerpo humano. [1] La poliomielitis y la viruela existen exclusivamente dentro de un reservorio humano. [5] Los seres humanos pueden actuar como reservorios de enfermedades de transmisión sexual, sarampión, paperas, infecciones estreptocócicas, diversos patógenos respiratorios y el virus de la viruela. [1]

Reservorios de animales Editar

Los reservorios animales (no humanos) consisten en animales domésticos y salvajes infectados por patógenos. [1] [2] Por ejemplo, la bacteria Vibrio cholerae, que causa el cólera en humanos, tiene reservorios naturales en copépodos, zooplancton y mariscos. Parásitos parásitos de la sangre del género Esquistosoma, responsables de la esquistosomiasis, pasan parte de su vida dentro de los caracoles de agua dulce antes de completar su ciclo de vida en los huéspedes vertebrados. [7] Virus del taxón Ebolavirus, que causa la enfermedad por el virus del Ébola, se cree que tiene un reservorio natural en los murciélagos u otros animales expuestos al virus. [8] Otras enfermedades zoonóticas que se han transmitido de animales a humanos incluyen: rabia, blastomicosis, psitacosis, triquinosis, enfermedad por arañazo de gato, histoplasmosis, coccidiomicosis y salmonela. [9]

Los reservorios animales comunes incluyen: murciélagos, roedores, vacas, cerdos, ovejas, cerdos, conejos, mapaches, perros y otros mamíferos. [1]

Reservorios de animales comunes Editar

Murciélagos Editar

Numerosas enfermedades zoonóticas se remontan a los murciélagos. [10] Hay un par de teorías que sirven como posibles explicaciones de por qué los murciélagos son portadores de tantos virus. Una teoría propuesta es que existen tantas enfermedades transmitidas por murciélagos porque existe una gran cantidad de especies e individuos de murciélagos. La segunda posibilidad es que algo en la fisiología de los murciélagos los convierta en huéspedes reservorios especialmente buenos. [10] Quizás las "elecciones alimentarias, la estructura de la población, la capacidad de volar, la migración estacional y los patrones de movimiento diario, el letargo e hibernación, la duración de la vida y los comportamientos de percha" de los murciélagos sean responsables de convertirlos en huéspedes reservorios especialmente adecuados. [11] Los lyssavirus (incluido el virus de la rabia), los virus Henipavirus, los virus Menangle y Tioman, los virus similares al SARS-CoV y los virus del Ébola se remontan a diferentes especies de murciélagos. [11] Los murciélagos frugívoros, en particular, sirven como reservorio del virus Nipah (NiV). [12]

Ratas Editar

Se sabe que las ratas son el reservorio de varias enfermedades zoonóticas. Se encontró que las ratas noruegas estaban infestadas con las espiroquetas de la enfermedad de Lyme. [13] En México, las ratas son portadoras de Trypanosoma cruzi, que causa la enfermedad de Chagas. [14]

Ratones Editar

Ratones de patas blancas (Peromyscus leucopus) son uno de los reservorios animales más importantes de la espiroqueta (Borrelia burgdorferi). [15] Los ratones ciervo sirven como reservorios del virus Sin Nombre, que causa el Síndrome Pulmonar por Hantavirus (SPH). [dieciséis]

Monos Editar

El virus Zika se originó en monos en África. En São José do Rio Preto y Belo Horizonte, Brasil, se ha encontrado el virus zika en monos muertos. La secuenciación del genoma ha revelado que el virus es muy similar al tipo que infecta a los humanos. [17]

Embalses ambientales Editar

Los reservorios ambientales incluyen reservorios vivos y no vivos que albergan patógenos infecciosos fuera de los cuerpos de los animales. Estos reservorios pueden existir en la tierra (plantas y suelo), en el agua o en el aire. [1] Los patógenos que se encuentran en estos reservorios a veces son de vida libre. Las bacterias Legionella pneumophila, un parásito intracelular facultativo que causa la enfermedad del legionario, y Vibrio cholerae, que causa el cólera, pueden existir tanto como parásitos de vida libre en ciertas fuentes de agua como en huéspedes animales invertebrados. [1] [18]

Un reservorio de enfermedad actúa como un punto de transmisión entre un patógeno y un huésped susceptible. [1] La transmisión puede ocurrir directa o indirectamente.

Transmisión directa Editar

La transmisión directa puede ocurrir por contacto directo o dispersión directa de gotas. La transmisión por contacto directo entre dos personas puede ocurrir por contacto cutáneo, besos y contacto sexual. Los seres humanos que sirven como reservorios de enfermedades pueden ser sintomáticos (mostrando la enfermedad) o asintomáticos (sin mostrar la enfermedad), actuar como portadores de la enfermedad y, a menudo, propagar la enfermedad sin saberlo. Los portadores humanos comúnmente transmiten enfermedades porque no se dan cuenta de que están infectados y, en consecuencia, no toman precauciones especiales para prevenir la transmisión. Las personas sintomáticas que conocen su enfermedad no tienen tanta probabilidad de transmitir la infección porque toman precauciones para reducir la posible transmisión de la enfermedad y / o buscan tratamiento para prevenir la propagación de la enfermedad. [1] La propagación directa de gotas se debe a partículas sólidas o gotas líquidas suspendidas en el aire durante algún tiempo. La propagación por gotitas se considera la transmisión del patógeno a un huésped susceptible dentro de un metro de distancia, pueden propagarse al toser, estornudar y hablar.

  • Neisseria gonorrhoeae (Gonorrea) se transmite por contacto sexual que involucra el pene, la vagina, la boca y el ano a través de la transmisión por contacto directo.
  • Bordetella pertussis (Tos ferina) se transmite por tos desde el reservorio humano al huésped susceptible a través de la propagación directa de gotitas.

Transmisión indirecta Editar

La transmisión indirecta puede ocurrir por transmisión aérea, por vehículos (incluidos los fómites) y por vectores.

La transmisión aérea es diferente de la propagación directa por gotitas, ya que se define como la transmisión de una enfermedad que tiene lugar a una distancia mayor de un metro. Los patógenos que pueden transmitirse a través de fuentes aéreas son transportados por partículas como polvo o residuos secos (denominados núcleos de gotitas).

Los vehículos como alimentos, agua, sangre y fómites pueden actuar como puntos de transmisión pasiva entre los reservorios y los huéspedes susceptibles. Los fomites son objetos inanimados (pomos de puertas, equipo médico, etc.) que se contaminan con una fuente de reservorio o alguien / algo que es portador. Un vehículo, como un depósito, también puede ser un entorno favorable para el crecimiento de un agente infeccioso, ya que entrar en contacto con un vehículo conduce a su transmisión.

La transmisión de vectores ocurre con mayor frecuencia por picaduras de insectos de mosquitos, moscas, pulgas y garrapatas. Hay dos subcategorías de vectores: mecánico (un insecto transmite el patógeno a un huésped sin que el propio insecto se vea afectado) y biológico (la reproducción del patógeno ocurre dentro del vector antes de que el patógeno se transmita a un huésped). Para dar algunos ejemplos, Morbillivirus (sarampión) se transmite de un huésped humano infectado a un huésped susceptible a medida que se transmiten por respiración a través de la transmisión aérea. Campylobacter (campilobacteriosis) es una infección bacteriana común que se transmite desde reservorios humanos o no humanos por vehículos como alimentos y agua contaminados. Plasmodium falciparum (malaria) puede transmitirse de un mosquito infectado, un reservorio animal (no humano), a un huésped humano mediante la transmisión de un vector biológico.


Control de Infección

El control práctico de enfermedades requiere respuestas a dos preguntas: 1) ¿Se puede lograr un nivel aceptable de control sin considerar un reservorio? 2) De no ser así, ¿qué poblaciones constituyen el reservorio? Dado un sistema objetivo-reservorio, las políticas para manejar la infección pueden contener elementos de tres tácticas ampliamente diferentes: 1) control del blanco: dirigir los esfuerzos dentro de la población objetivo sin hacer referencia al reservorio (p. Ej., Vacunación humana contra la fiebre amarilla [23]) 2 ) tácticas de bloqueo: dirigir los esfuerzos de control para bloquear la transmisión entre las poblaciones de origen y objetivo (por ejemplo, vallas de caza para controlar el virus de la fiebre aftosa en el ganado) y 3) control del reservorio: controlar la infección dentro del reservorio (por ejemplo, programas de sacrificio, vacunación o tratamiento de reservorios) . Estos tres enfoques requieren niveles cada vez mayores de comprensión de la estructura y función del yacimiento.

El control de blancos tiene la importante ventaja de que no requiere conocimiento de la dinámica del yacimiento potencialmente compleja. Tampoco es necesario un conocimiento completo de la dinámica de la infección dentro del reservorio para implementar tácticas de bloqueo, aunque es esencial identificar las poblaciones de origen en el reservorio. Cuanto más precisamente se puedan identificar las poblaciones de origen y más datos cuantitativos disponibles sobre su contribución relativa a la transmisión, más eficiente será la asignación de recursos para el control de enfermedades. Las tácticas de control del reservorio requieren una comprensión mucho más completa de la estructura y los procesos de transmisión que ocurren dentro del reservorio. Por ejemplo, es poco probable que los esfuerzos dirigidos a controlar la infección en los componentes que no son de mantenimiento de un reservorio sean efectivos si la infección en el componente de mantenimiento del reservorio permanece incontrolada.

El problema práctico de identificar reservorios de rabia para humanos en Zimbabwe proporciona una ilustración útil de algunos de los problemas involucrados. Después de un aumento en la incidencia de la rabia de los chacales y los perros en la década de 1990, el debate se ha centrado en si los chacales (Canis adustus) son reservorios de esta enfermedad, tema que tiene importantes implicaciones para la formulación de programas nacionales de control de la rabia (10,11). En Zimbabwe, los perros domésticos son una población de mantenimiento y fuente de rabia para los seres humanos. Sin embargo, los chacales representan & # x0003e25% de todos los casos confirmados de rabia en animales y también son una fuente importante de infección para los seres humanos (10,11). Los chacales pueden ser componentes importantes del reservorio como población de mantenimiento o no mantenimiento (Figura 2). Debido a que la rabia se puede mantener en perros sin chacales, los chacales no son una población constituyente esencial del reservorio. Pero, ¿puede persistir la infección en los chacales sin perros (Figura 2B)? Los chacales pueden constituir parte de una comunidad de mantenimiento junto con un conjunto de otros carnívoros salvajes (Figura 2A). La pregunta es importante porque si los perros son la única población de mantenimiento en el reservorio, las campañas de vacunación efectivas dirigidas a los perros deberían eliminar con éxito la rabia humana en Zimbabwe. Sin embargo, si los chacales comprenden todo o parte de una comunidad de mantenimiento independiente de los perros, la eliminación de la rabia solo tendrá éxito si también se controla la rabia de los chacales (10,11). La reciente alta incidencia de la rabia del chacal en Zimbabwe podría sugerir que los chacales son poblaciones de mantenimiento. Una alta incidencia de la enfermedad por sí sola no es evidencia necesaria ni suficiente para esta afirmación, particularmente cuando ocurren grandes fluctuaciones en la incidencia de la enfermedad (como con la rabia del chacal). Los modelos matemáticos sugieren que los chacales probablemente no pueden soportar la infección sin reintroducciones frecuentes de fuentes externas (24). Sin embargo, Bingham et al. (11) argumentan que los patrones espaciales son críticos y que las epidemias de chacal pueden sostenerse de forma independiente dentro de áreas geográficas clave. El problema se puede resolver de manera inequívoca mediante la implementación de una campaña de vacunación masiva de perros, que sería una primera fase lógica de un programa nacional. Si la rabia del chacal persiste en ausencia de rabia canina, un programa eficaz para la eliminación de la rabia probablemente necesitará incluir la vacunación oral de los chacales.

Potencial complejidad de los reservorios de rabia en Zimbabwe. Si los chacales con (A) o sin (B) otras poblaciones de carnívoros silvestres constituyen una comunidad de mantenimiento independiente de los perros, entonces la vacunación de los perros por sí sola no resultará en la eliminación de la rabia en el objetivo. Si los chacales no constituyen una comunidad de mantenimiento independiente de los perros (C), la vacunación del perro debería eliminar la rabia del reservorio (símbolos como en la Figura 1).

La rabia también proporciona un ejemplo de la necesidad de identificar una población objetivo al definir los reservorios. En la llanura del Serengeti en Tanzania, una cepa distinta de rabia parece mantenerse de forma independiente en las hienas manchadas, sin causarles ninguna enfermedad clínica y sin evidencia de infección o enfermedad de desbordamiento que ocurra en ninguna otra especie (dentro de los límites del conocimiento actual). (25). Según nuestra definición, a menos que esta cepa se identifique como la causa de la enfermedad en otra especie (es decir, una población objetivo), las hienas en el Serengeti no pueden considerarse reservorios de rabia.


¿Puede un reservorio hospedador actuar como vector? - biología

La fiebre severa con síndrome de trombocitopenia (SFTS) es una fiebre hemorrágica emergente en el este de Asia causada por el virus SFTS (SFTSV), un flebovirus recién descubierto. los Haemaphysalis longicornis Se sospecha que la garrapata es el vector del SFTSV. Para determinar si el SFTSV se puede transmitir entre garrapatas, de garrapatas a animales y de animales a garrapatas, realizamos estudios de transmisión entre las etapas de desarrollo de H. longicornis garrapatas y entre garrapatas y ratones. Utilizando PCR de transcripción inversa, también analizamos la prevalencia de la infección por SFTSV entre H. longicornis garrapatas recolectadas de la vegetación en la provincia de Shandong, China. Nuestros resultados mostraron una baja prevalencia de SFTSV entre las garrapatas recolectadas (0,2%, 8/3300 garrapatas), y demostramos que las garrapatas alimentadas en ratones infectados con SFTSV podrían adquirir el virus y transmitirlo transestadial y transovarialmente a otras etapas de desarrollo de las garrapatas. Además, las garrapatas infectadas con SFTSV podrían transmitir el virus a los ratones durante la alimentación. Nuestros hallazgos indican que las garrapatas podrían servir como vector y reservorio de SFTSV.

La fiebre severa con síndrome de trombocitopenia (SFTS) es una fiebre hemorrágica emergente causada por el virus SFTS (SFTSV), un flebovirus recientemente descubierto en la familia. Bunyaviridae (1,2). SFTS se informó en China en 2009 (1) y posteriormente en Corea y Japón (3,4). Aproximadamente 1,000 casos de SFTS se reportan cada año en China (5), donde la tasa de letalidad es del 6,3% al 12,0% (1,5). Los casos de SFTS ocurren en áreas rurales de China, donde hay arbustos, praderas o ambos, y una alta densidad de Haemaphysalis longicornis garrapatas1,69). Desde el primer descubrimiento de SFTSV, la transmisión del virus por garrapatas, especialmente la H. longicornis garrapata, se ha propuesto1). Sin embargo, no se ha determinado si SFTSV puede transmitirse transestadial y transováricamente en garrapatas o si las garrapatas pueden transmitir SFTSV a animales. Para determinar la posibilidad de tal transmisión y para determinar si las garrapatas podrían ser un reservorio de SFTSV, investigamos las garrapatas como un posible vector determinando la transmisión de SFTSV por garrapatas durante las etapas de desarrollo de las garrapatas y la transmisión de SFTSV a los animales.

Materiales y métodos

Colección de garrapatas de la vegetación

Durante junio y julio de 2013, recolectamos garrapatas (en busca de larvas, ninfas y adultos) en el condado de Jiaonan, provincia de Shandong, China (119 ° 30′-120 ° 30 ′, 35 ° 35′-36 ° 08 ′), marcando sobre vegetación con una bandera de franela de 1 m 2. La recolección de garrapatas se realizó durante 4 días durante la primera semana de cada mes entre las 10:00 am y las 12:00 pm y entre las 2:00 pm y las 5:00 pm se utilizaron diferentes sitios para cada recolección. Las garrapatas se congelaron a -80 ° C hasta su uso. Las especies de garrapatas y las etapas de desarrollo se identificaron morfológicamente y la especie de garrapata se confirmó molecularmente. El uso de los animales y la recolección de muestras fueron aprobados por el comité de bioética de la Escuela de Salud Pública de la Universidad de Shandong.

Identificación y extracción de nucleótidos de garrapatas mediante PCR

Las garrapatas se agruparon de acuerdo con sus etapas de desarrollo, cada grupo contenía 40 larvas, 20 ninfas o 5 garrapatas adultas. Se ignoró el sexo de las garrapatas. Las garrapatas de cada grupo se homogeneizaron utilizando perlas metálicas y tampón RLT en un TissueLyser LT (ambos de QIAGEN, Hilden, Alemania). Los nucleótidos totales (ADN y ARN) se extrajeron simultáneamente utilizando el Mini Kit AllPrep ADN / ARN (QIAGEN) de acuerdo con las instrucciones del fabricante. Se procesaron individualmente dos garrapatas larvarias, 1 garrapata ninfal y 2 garrapatas adultas para la extracción del ARNr y la amplificación por PCR del gen del ARNr 16S mitocondrial de la garrapata. El cebador directo del gen del ARN 16S mitocondrial de garrapata (5′-AGTATTTTGACTATACAAAGGTATTG-3 ′) y el cebador inverso (5′-GTAGGATTTTAAAAGTTGAACAAACTT-3 ′) se diseñaron en este estudio utilizando una secuencia previamente publicada (número de acceso de GenBank KC203361) como plantilla. El ciclo de PCR consistió en un paso inicial de desnaturalización del ADN a 95 ° C durante 2 min 35 ciclos de 30 sa 92 ° C, 30 sa 55 ° C y 45 sa 72 ° C y un paso de extensión final de 10 min a 72 ° C. El producto de la PCR tenía 402 pb y se secuenció en ambas cadenas.

Detección de SFTSV en garrapatas mediante PCR de transcripción inversa (RT-PCR)

El ARN de SFTSV extraído se amplificó utilizando una RT-PCR de un solo paso (Access RT-PCR System Kit, Promega, Madison, WI, EE. UU.) Con cebadores derivados del segmento de ARN pequeño del virus. Los cebadores de RT-PCR (CAGCCAGTTTACCCGAACAT y GAAAGACGCAAAGGAGT) y el protocolo de PCR se describieron previamente (10). La RT-PCR de un solo paso consistió en 45 min a 45 ° C y 2 min a 94 ° C 40 ciclos de 30 sa 94 ° C, 1 min a 60 ° C y 2 min a 68 ° C y una extensión final de 10 min a 68ºC. El producto de RT-PCR se utilizó como molde para una PCR anidada, que consistió en un ciclo de desnaturalización de 5 min a 95 ° C 30 ciclos de 20 sa 94 ° C, 30 sa 56 ° C y 1 min a 72 ° C y una extensión final de 10 min a 72 ° C. Se corrió simultáneamente un control negativo con agua destilada esterilizada. La PCR anidada se realizó con cebadores (5′-TGGCTCCGCGCATCTTCACA-3 ′ y 5′-AGAGTGGTCCAGGATTGCTGTGG-3 ′), utilizando el producto de RT-PCR como plantilla (11). El ADN amplificado se sometió a electroforesis en un gel de agarosa al 0,8% y se visualizó bajo luz ultravioleta. La banda de ADN de 560 pb deseada se cortó y se purificó del gel utilizando el kit de extracción de gel (QIAGEN). El producto de PCR purificado se clonó en un vector pMD 19-T (TaKaRa Bio Inc., Shiga, Japón), de acuerdo con las instrucciones del fabricante. Los clones positivos se secuenciaron en ambas cadenas.

Análisis filogenético

Las secuencias de SFTSV y las secuencias del gen de ARNr 16S mitocondrial de garrapatas derivadas de nucleótidos de garrapatas se compararon con secuencias en GenBank utilizando BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Los árboles filogenéticos se construyeron utilizando el método de unión de vecinos en MEGA5 (12), y la robustez de los árboles se probó mediante el uso de 1.000 réplicas de bootstrap. Las secuencias generadas en este estudio se depositaron en GenBank (números de acceso KP300821, KR259990 – KR25993 para garrapatas y KP197680 – KP197687 para SFTSV).

Establecimiento de una colonia de garrapatas y experimentos de alimentación de transmisión

Una colonia de partenogénicos H. longicornis tick se estableció en nuestro laboratorio. Inicialmente, las garrapatas hembras adultas recolectadas de la vegetación se colocaron dentro de una bolsa unida a una oreja de conejo para alimentarse. Se permitió que cada garrapata congestionada pusiera huevos en un tubo de plástico. Aproximadamente la mitad de la nidada de huevos de cada garrapata hembra se utilizó para la extracción de ARN y la prueba de SFTSV mediante RT-PCR. Se permitió que las larvas eclosionaran de las mitades de nidadas restantes, y las larvas de una sola garrapata que resultó negativa para SFTSV por RT-PCR se utilizaron para todos los experimentos posteriores.

La alimentación por transmisión y adquisición de SFTSV se realizó para todas las etapas de las garrapatas utilizando ratones Kunming (Centro de Animales Experimentales de la Universidad de Shandong, ciudad de Jinan, China). Para los experimentos, se colocaron garrapatas en cápsulas de alimentación, que se prepararon a partir de la parte superior de crioviales con tapón de rosca de 1 ml. Se cortó la parte superior del tubo debajo de la tapa y se pinchó la tapa del tubo utilizando una aguja de calibre 26 para un intercambio de aire adecuado. Los ratones se anestesiaron mediante inyección intraperitoneal de 0,1 ml de hidrato de cloral al 10%. El pelo de la parte posterior de cada ratón se recortó cerca de la piel utilizando una pequeña maquinilla de afeitar eléctrica y se colocó una cápsula en la parte posterior con pegamento Kamar (Kamar Products Inc., Zionsville, IN, EE. UU.). Para asegurar la cápsula en su lugar, se colocó sobre la cápsula un parche redondo de tela (≈1 cm de diámetro) con un orificio en el medio que era un poco más pequeño que la cápsula (para permitir el acceso a la cápsula) y se fijó a la piel con pegamento. Se colocó un collar hecho de plástico delgado alrededor del cuerpo del ratón en frente de la cápsula para evitar que el ratón quitara la cápsula durante el aseo.

Se colocó un total de 50 larvas, 15 ninfas o 1 garrapata adulta en la cápsula de cada ratón 24 h después de que la cápsula se fijara al ratón. Las garrapatas en la cápsula se observaron diariamente y se recolectaron después de completar la alimentación. Para la alimentación por adquisición de virus, se inoculó a cada ratón por vía intraperitoneal con células DH82 que contenían 106 unidades formadoras de placa de SFTSV, y se alimentaron garrapatas en los ratones infectados con SFTSV durante 3 a 8 días hasta que se llenaron de sangre. Para la alimentación por transmisión de virus, las garrapatas infectadas con SFTSV se alimentaron en ratones no infectados durante 3 a 8 días hasta que se llenaron de sangre. Recolectamos muestras de sangre de cada ratón 7, 14 y 21 días después de la alimentación de garrapatas para la detección de SFTSV. El SFTSV en las garrapatas criadas en laboratorio y en la sangre del ratón se detectó mediante RT-PCR utilizando el par de cebadores CAGCCACTTCACCCGAACAT y AAGGAAAGACGCAAAGGAG, que se diseñó en este estudio. Los ciclos de amplificación fueron los mismos que los descritos anteriormente para la RT-PCR para la detección de SFTSV en garrapatas de la vegetación. El producto de PCR fue de 560 pb.

Detección de ARN y anticuerpos de SFTSV en sangre de ratones después de la alimentación de garrapatas

Se recolectaron muestras de sangre de ratón semanalmente durante 3 semanas. El ARN total se extrajo de cada muestra de sangre utilizando el RNeasy Mini Kit (QIAGEN) y se utilizó como plantilla para la amplificación (Access RT-PCR System Promega) de SFTSV. Los cebadores para RT-PCR y el protocolo de PCR fueron los descritos en el párrafo anterior. El anticuerpo SFTSV se ensayó usando células DH82 infectadas con SFTSV como antígenos. Las células se cultivaron en una placa de 96 pocillos, se fijaron con paraformaldehído al 4% y se utilizaron como antígenos para ensayos de inmunofluorescencia (IFA) para detectar anticuerpos contra SFTSV en muestras de suero de ratones alimentados por garrapatas infectadas con SFTSV.

Resultados

La prevalencia de SFTSV en garrapatas de la vegetación

Figura 1. Análisis filogenético del gen de rRNA 16S mitocondrial de garrapatas recolectadas durante junio-julio de 2014 en el condado de Jiaonan, provincia de Shandong, China. Los resultados mostraron que las garrapatas larvales, ninfales y adultas (indicadas por.

Figura 2. Análisis filogenético de secuencias de pequeños segmentos del virus de la fiebre severa con síndrome de trombocitopenia (SFTSV) de garrapatas recolectadas entre junio y julio de 2014 en el condado de Jiaonan, provincia de Shandong, China. Los puntos indican secuencias de SFTSV amplificadas.

Recolectamos 3.300 garrapatas de la vegetación, las identificamos morfológicamente como H. longicornis garrapatas, y confirmó molecularmente la identificación mediante la secuenciación del gen del ARN 16S mitocondrial de representantes de garrapatas larvales, ninfales y adultas (Figura 1). Para detectar SFTSV, agrupamos las garrapatas de acuerdo con su etapa de desarrollo y probamos cada grupo para detectar ARN de SFTSV mediante RT-PCR y PCR anidada. La prevalencia de la infección por SFTSV en cada etapa de la garrapata se determinó asumiendo que un grupo positivo de garrapatas contenía 1 garrapata infectada por SFTSV. La prevalencia de la infección por SFTSV fue del 0,2% (8/3300) entre las garrapatas de todos los estadios. La prevalencia de infección por SFTSV fue 0 entre 120 larvas, 0,1% (2/1620) entre ninfas y 0,4% (6/1560) entre garrapatas adultas. El análisis filogenético mostró que todas las secuencias de SFTSV amplificadas a partir de garrapatas se agruparon con SFTSV de la provincia de Shandong y otros lugares de China (Figura 2). Estos resultados sugirieron que las ninfas y las garrapatas adultas estaban infectadas con SFTSV, pero la tasa de porte fue muy baja.

Infección de garrapatas por SFTSV por alimentación por adquisición y transmisión transovárica por garrapatas de SFTSV

Para determinar si las garrapatas podrían estar infectadas por SFTSV, alimentamos todas las etapas (larvas, ninfas y adultos) de H. longicornis garrapatas en ratones infectados con SFTSV. En la alimentación de adquisición de larvas, las larvas congestionadas se analizaron para SFTSV mediante RT-PCR antes o después de la muda. Se agruparon cinco garrapatas larvarias como un conjunto para la extracción de ARN y la amplificación por RT-PCR de SFTSV. La tasa mínima de infección (asumiendo que un grupo de garrapatas infectadas contenía 1 garrapata infectada con SFTSV) fue del 18% (9/50) para los grupos de larvas congestionados y del 11,7% (14/120) para las ninfas mudadas (Tabla 1). Estos resultados indicaron que las larvas podrían adquirir SFTSV de ratones infectados y transmitir SFTSV transestadialmente a las ninfas.

En la alimentación por adquisición de ninfas, se probaron individualmente 10 ninfas congestionadas y se encontró que todas estaban infectadas con SFTSV; sin embargo, solo el 20% (2/10) de las garrapatas adultas derivadas de las ninfas estaban infectadas con SFTSV (Tabla 1). Estos resultados indicaron que las ninfas podrían adquirir SFTSV de ratones infectados y transmitir SFTSV transestadialmente a garrapatas adultas.

Para la alimentación por adquisición de garrapatas adultas, se alimentaron garrapatas adultas no infectadas en ratones infectados con SFTSV hasta que se completó la alimentación. Se analizaron individualmente 13 garrapatas adultas congestionadas para detectar SFTSV, y 6 (46,2%) de ellas estaban infectadas con SFTSV, según lo determinado por RT-PCR. Trece garrapatas adultas congestionadas habían ovipositado y las larvas eclosionaron. Las larvas derivadas de cada garrapata se analizaron como grupo para detectar ARN de SFTSV mediante RT-PCR, y el 53,8% (7/13) de las agrupaciones de larvas se infectaron con SFTSV (Tabla 1). Los resultados de estos experimentos indicaron que las garrapatas hembras adultas podrían transmitir SFTSV transováricamente.

Marque la transmisión de SFTSV a ratones

Para determinar si SFTSV podría transmitirse a ratones por picadura de garrapata, alimentamos a ninfas y adultos infectados con SFTSV en ratones albinos Kunming. Para el estudio de la transmisión de SFTSV por alimentación de ninfas, 10 ratones no infectados fueron alimentados por 10 ninfas mudadas de larvas que se alimentaron de ratones infectados con SFTSV hasta que se ingurgitaron. A los 7, 14 y 21 días después de la alimentación, se obtuvieron muestras de sangre de los ratones y se examinaron mediante RT-PCR para detectar ARN viral SFTSV se detectó en el 40% (4/10) de los ratones. Estos resultados indicaron que las ninfas transmitían SFTSV a los ratones a través de la alimentación.

Para el estudio de la transmisión de SFTSV por alimentación de garrapatas adultas, las garrapatas adultas se mudaron de ninfas congestionadas obtenidas de los 10 ratones mencionados anteriormente. Para determinar si el SFTSV se transmitió de las ninfas a las garrapatas adultas y si las garrapatas adultas podían transmitir el SFTSV a los ratones, se alimentaron 20 garrapatas adultas individualmente en 20 ratones sin tratamiento previo hasta que se llenaron de sangre. A los 7, 14 y 21 días después de la alimentación, se obtuvieron muestras de sangre de los ratones y se examinaron mediante RT-PCR para detectar el ARN viral SFTSV se detectó en el 10.0% (2/20) de los ratones los días 7 y 14. Estos Los resultados indicaron que las garrapatas adultas utilizadas en este estudio se infectaron en la etapa larvaria al alimentarse de ratones infectados con SFTSV.

Figura 3. Detección por ensayo de inmunofluorescencia de anticuerpos contra el virus del síndrome de trombocitopenia (SFTSV) en muestras de suero de ratones alimentados por garrapatas infectadas con SFTSV. A) Suero de ratón normal (control negativo) que reacciona con DH82 infectado con SFTSV.

Usando un IFA, determinamos si los anticuerpos SFTSV estaban presentes en muestras de suero de ratones alimentados por garrapatas ninfales y adultas. Todas las muestras de suero de ratón SFTSV RT-PCR-positivas también fueron positivas por IFA en varios títulos (Tabla 2 Figura 3), pero ninguna de las muestras de ratón SFTSV RT-PCR-negativas fue positiva por IFA. Los resultados indicaron que las larvas adquirieron SFTSV de ratones infectados y transmitieron el virus transestadialmente a ninfas y garrapatas adultas, y las ninfas y garrapatas adultas transmitieron SFTSV a ratones durante la alimentación.

Discusión

Se ha creído que el SFTSV es un virus transmitido por garrapatas desde que se descubrió por primera vez porque se detectó en garrapatas recolectadas de animales (1). However, detection of a virus in feeding ticks collected from animals does not confirm that the tick is a vector or reservoir of the virus it is possible that ticks can acquire a virus from the blood of an infected animal but not maintain it transstadially and transmit it during feeding. Several studies have tried to demonstrate that ticks are a vector and reservoir of SFTSV (13,14). These studies either failed to detect SFTSV in a large quantity of ticks (n = 11,739) (13) or demonstrated very low prevalence of SFTSV in ticks collected from vegetation (14). A recent study from South Korea demonstrated that SFTSV was detected in all developmental stages of H. longicornis ticks, but the prevalence of infection was low in larvae (0.6% [2/350]) and nymphs (0.4% [38/10, 436]) (14). In this study, we demonstrated that the prevalence of SFTSV infection in ticks collected from vegetation is also low (0.2%). A recent study reported a slightly higher prevalence of SFTSV infection (2.2%) in H. longicornis ticks collected from vegetation from Shandong Province (15). The findings from these studies demonstrate that the prevalence of SFTSV infection in tick populations is very low. The reason for the low SFTSV infection rate in nature is not clear. It may be that SFTSV is detrimental to the infected tick and affects its survival. The low SFTSV prevalence in ticks suggests that ticks alone may not be sufficient to maintain SFTSV in nature circulation of SFTSV between the tick vector and mammalian amplifying hosts may be required for SFTSV maintenance in nature. In previous studies, we and others demonstrated that SFTSV can infect domesticated animals (goats, sheep, cattle, dogs, and chickens) (69) and wild small mammals (mice, rats, and Asian house shrews) (16). These animals may be amplifying hosts and ticks may be a vector and reservoir host of SFTSV.

This study and previous studies (15,17) demonstrated that H. longicornis is the predominant tick species in eastern China. H. longicornis ticks feed on domesticated and wild animals, including goats, sheep, cattle, pigs, deer, cats, dogs, rats, mice, hedgehogs, chickens, and other birds, as well as on humans (18). In rural China, domesticated animals, especially goats and dogs, often roam freely in the environment and maintain a high tick population around farm houses and may increase the risk of SFTSV infection in humans.

One limitation of this study is that a single species of tick was evaluated as a vector and reservoir of SFTSV. The virus has also been detected in Rhipicephalus microplus (antes Boophilus microplus), Amblyomma testudinarium, y Ixodes nipponensis ticks in China and South Korea (19,20). However, these ticks are not dominant ticks in eastern China, and whether these tick species play a role in the natural cycle of SFTSV needs to be further investigated. SFTSV has also been detected by RT-PCR in Leptotrombidium scutellare mites collected from Apodemus agrarius mice and from Laelaps echidnina mites collected from A. agrarius mice and goats in Jiangsu Province, China (21), and from the gadfly (species not defined) in the family Tabanidae in Henan Province, China (17). Other than ticks, the role of other bloodsucking insects as the vector and reservoir for SFTSV needs to be further investigated.

In this study, we demonstrated that H. longicorn ticks at each developmental stage acquired SFTSV during feeding on experimentally infected mice and transmitted SFTSV to mice during feeding. For acquisition feeding, the larval tick appeared to be less efficient than nymphal and adult ticks at acquiring SFTSV from infected mice. However, the difference between infection acquisition for larval ticks and for nymphal and adult ticks may be due to the manner in which we determined the prevalence of SFTSV infection among the different stages of ticks. For larval ticks, prevalence was determined on the basis of the minimum infection rate that was calculated by using pools of ticks for nymphal and adult ticks, prevalence was determined on the basis of the infection rate that was calculated by using individual ticks. The minimum infection rate may underestimate the true infection rate because a positive pool is counted for only 1 positive tick even though the pool may contain >1 positive tick. We also demonstrated that SFTSV can be transstadially transmitted from larvae to nymphal and adult ticks. However, we may have underestimated the efficiency of transstadial transmission in each tick developmental stage because a larval population fed on an infected mouse was used for transstadial transmission, and the larvae may have included SFTSV-infected and noninfected ticks.

In this study, tick acquisition of SFTSV and transstadial transmission of SFTSV were demonstrated by RT-PCR detection of SFTSV RNA in ticks and confirmed by IFA detection of antibodies to SFTSV in mice fed on by SFTSV-infected nymphal and adult ticks. However, transovarial transmission of SFTSV in ticks was demonstrated only by RT-PCR, which may need further confirmation by isolation of SFTSV from tick eggs or larvae or from mice fed on by hatched larvae or by detection of antibodies to SFTSV in mice fed on by hatched larvae.

In conclusion, all developmental stages of H. longicorn ticks can acquire SFTSV by feeding on experimentally infected mice, and the ticks can transmit SFTSV to mice during feeding. The virus can be passed transstadially and transovarially in the developmental stages of the tick. However, the prevalence of SFTSV infection among ticks collected from vegetation is quite low, suggesting that ticks alone (at least H. longicorn ticks) may not be sufficient to maintain the virus in nature.

Ms. Luo is a PhD student in the School of Public of Health, Shandong University. Her research interest is the epidemiology of tickborne infectious diseases.


From Vector To Zoonotic: A Glossary For Infectious Diseases

The world is in a hyperinfectious era. And that means there are a lot of words being tossed around that you might not be familiar with. Or maybe you have a general idea of what they mean but wish you knew more.

Here are some key terms and definitions. And yes, there will be a quiz (coming in March so you have time to study).

What Causes Pandemics? We Do

In this series, NPR explores the causes behind our new hyperinfectious era. Join the conversation with the hashtag #KillerViruses or tweet us @NPRGoatsAndSoda

Epidemic: A sudden increase in the number of cases of a disease in a particular geographic area, beyond the number health officials typically expect. An increase that occurs in a relatively small geographic area or among a small group of people may be called an "outbreak."

For example, the Centers for Disease Control and Prevention calls HIV/AIDS, which affects 1.2 million people in the United States, an "epidemic." By contrast, the CDC called two cases of sickness from drinking raw milk (listeriosis) in the United States an "outbreak."

Goats and Soda

MAP: Find Out What New Viruses Are Emerging In Your Backyard

Pandemic: An epidemic spanning many countries and/or several continents. The difference between an outbreak, an epidemic and a pandemic can be murky and depends on the opinions of scientists and health officials.

Emerging disease: A disease that occurs in the population of a certain geographic region for the first time, or a disease that's been present at low levels in a region but then rapidly reaches new peaks in the number of cases reported.

Animal-human interface: The points of contact between animals and humans — when people cut down forests and set up dwellings where forest animals are still prevalent, for example. Some types of diseases spread from animals to humans at this interface. (Note: In all these definitions "animal" refers to nonhuman animals.)

Germ History: Episode 1

VIDEO: When Humans Got Cozy, Germs Got Deadly

Germ History: Episode 2

VIDEO: From Measles To Syphilis, How We Created The Golden Age Of Germs

Reservoir: An animal, plant or environment in which a disease can persist for long periods of time. For example, some bats serve as a reservoir for rabies and can spread the disease by biting humans. But the bats — and other reservoir species — may not experience symptoms because of built-in immunity.

Germ History: Episode 3

Germ History: Milkmaids Inspire Vaccines, But The Germs Keep Coming

A disease reservoir is analogous to a water reservoir. But instead of supplying water, a disease reservoir serves as a supply for a virus or other pathogen.

Vector: Any living creature that can pass an infection to another living creature. Humans are technically vectors, but the term is more commonly applied to nonhuman organisms.

Spillover: The transmission of a disease from one species to another. Sometimes a disease may reside in a plant or animal or even in soil, and then spread to humans. This spread of disease is called a "spillover event."

Index case: The first case of a disease known to health officials. Some epidemiologists may refer to an index case as "patient zero."

Zoonotic: Any disease that spreads from animals to people. The animals can range from tiny ticks to lumbering cattle.

One Health: This two-word phrase embodies the view that there's no such thing as just human health or just animal health or just the health of the environment — they're all part of One Health. That's because the health of humans is closely linked to the health of the environment and other animals. Proponents of One Health believe medical doctors, ecologists, veterinarians and other specialists should work together to improve a community's health.

Microbio: A living thing too small for the eye to see, such as bacteria, fungi or viruses. Many microbes are harmless and may even benefit other living things. But some can cause disease among humans, other animals and plants. Microbes that cause disease are called "pathogens" and are informally referred to as "germs."

Epidemiólogo Peter Krause of the Yale School of Public Health provided invaluable input for these definitions.

What do you want to know about pandemics? Share your questions by submitting them in our special tool here. Our global health team will answer some of them in an upcoming story.


Minor cultures as hosts for vectors of extensive crop diseases: Does Salvia sclarea act as a pathogen and vector reservoir for lavender decline?

Stolbur is a phytoplasma disease affecting crops worldwide. The planthopper Hyalesthes obsoletus is the main natural vector of ‘Candidatus Phytoplasma solani’ responsible of stolbur. In France, lavender (Lavandula angustifolia) and lavandin (Lavandula × intermedia) are strongly affected by this phytoplasma. These plant species are both hosts for the phytoplasma and its insect vector. In 2011, catches of adults were exceptionally sizable on one of the clones of lavandin most tolerant to lavender decline. A high population level of ‘Ca. P. solani’ vector was also observed on the adjacent plot of clary sage, Salvia sclarea. In order to clarify the potential role of S. sclarea as a host plant for H. obsoletus and ‘California. P. solani,’ we conducted field surveys and laboratory experiments. The uprooting of clary sage and root examination showed the presence of nymphs during winter. Harvested nymphs have been reared on S. sclarea from seedlings in a greenhouse for many generations. By performing its whole lifecycle on clary sage, we demonstrated for the first time that S. sclarea is a host plant of H. obsoletus and could be a source of stolbur vector. Nevertheless, status of clary sage as host plant of phytoplasma in the field up to now is not so clear. On 42 Q-PCR runs done on S. sclarea, 41 were negative to the phytoplasma, and one positive. Experimental transmission with infected H. obsoletus sampled on infected lavender showed that clary sage plant could be infected, expressed symptoms and multiplied ‘Ca. P. solani.’

Esta es una vista previa del contenido de la suscripción, acceda a través de su institución.


Embalses y transportistas

For pathogens to persist over long periods of time they require reservorios donde residen normalmente. Los embalses pueden ser organismos vivos o sitios inertes. Los reservorios inertes pueden incluir suelo y agua en el medio ambiente. Estos pueden albergar naturalmente al organismo porque puede crecer en ese entorno. Estos entornos también pueden contaminarse con patógenos en las heces humanas, patógenos diseminados por huéspedes intermediarios o patógenos contenidos en los restos de huéspedes intermediarios.

Los patógenos pueden tener mecanismos de latencia o resiliencia que les permitan sobrevivir (pero normalmente no reproducirse) durante períodos de tiempo variables en entornos sin vida. Por ejemplo, Clostridium tetani sobrevive en el suelo y en presencia de oxígeno como endospora resistente. Aunque muchos virus se destruyen pronto una vez que entran en contacto con el aire, el agua u otras condiciones no fisiológicas, ciertos tipos son capaces de persistir fuera de una célula viva durante períodos de tiempo variables. For example, a study that looked at the ability of influenza viruses to infect a cell culture after varying amounts of time on a banknote showed survival times from 48 hours to 17 days, depending on how they were deposited on the banknote. [1] On the other hand, cold-causing rhinoviruses are somewhat fragile, typically surviving less than a day outside of physiological fluids.

Un ser humano que actúa como reservorio de un patógeno puede o no ser capaz de transmitir el patógeno, según la etapa de la infección y el patógeno. Para ayudar a prevenir la propagación de enfermedades entre los niños en edad escolar, los CDC han desarrollado pautas basadas en el riesgo de transmisión durante el curso de la enfermedad. Por ejemplo, los niños con varicela se consideran contagiosos durante cinco días desde el inicio de la erupción, mientras que los niños con la mayoría de las enfermedades gastrointestinales deben permanecer en casa durante 24 horas después de que desaparezcan los síntomas.

Un individuo capaz de transmitir un patógeno sin mostrar síntomas se denomina portador. A passive carrier is contaminated with the pathogen and can mechanically transmit it to another host however, a passive carrier is not infected. Por ejemplo, un profesional de la salud que no se lava las manos después de ver a un paciente que alberga un agente infeccioso podría convertirse en un portador pasivo, transmitiendo el patógeno a otro paciente que se infecta.

By contrast, an portador activo is an infected individual who can transmit the disease to others. Un portador activo puede presentar o no signos o síntomas de infección. For example, active carriers may transmit the disease during the incubation period (before they show signs and symptoms) or the period of convalescence (after symptoms have subsided). Active carriers who do not present signs or symptoms of disease despite infection are called asymptomatic carriers. Pathogens such as hepatitis B virus, herpes simplex virus, y VIH are frequently transmitted by asymptomatic carriers. Mary Mallon, better known as Typhoid Mary, is a famous historical example of an asymptomatic carrier. An Irish immigrant, Mallon worked as a cook for households in and around New York City between 1900 and 1915. In each household, the residents developed fiebre tifoidea (causado por Salmonella typhi) unas semanas después de que Mallon comenzara a trabajar. Investigaciones posteriores determinaron que Mallon fue responsable de al menos 122 casos de fiebre tifoidea, cinco de los cuales fueron fatales. [2] See “Typhoid Mary” in Bacterial Infections of the Gastrointestinal Tract for more about the Mallon case.

Un patógeno puede tener más de un reservorio vivo. En las enfermedades zoonóticas, los animales actúan como reservorios de enfermedades humanas y transmiten el agente infeccioso a los humanos a través del contacto directo o indirecto. En algunos casos, la enfermedad también afecta al animal, pero en otros casos el animal está asintomático.

In parasitic infections, the parasite’s preferred host is called the definitive host. En los parásitos con ciclos de vida complejos, el huésped definitivo es el huésped en el que el parásito alcanza la madurez sexual. Some parasites may also infect one or more intermediate hosts en el que el parásito pasa por varias etapas del ciclo de vida inmaduro o se reproduce asexualmente.

Think about It

  • List some nonliving reservoirs for pathogens.
  • Explain the difference between a passive carrier and an active carrier.

What is a Vector

A vector is a living organism, mostly an arthropod, that carries a disease-causing pathogen from one to another host. Basically, there can be two types of vector transmission. They are the mechanical and biological transmission. In the mechanical transmission, the vector that transmits the pathogen from one to another host is not infected by the pathogen. For example, flies that land on the faecal matter can come into contact with bacteria in the faeces . But later, they shed these bacteria to food when they land on it. Although these bacteria cause diseases, including diarrhoea , dysentery, etc. in humans, flies are not infected with bacteria.

Figura 2: Anopheles stephensi – Malarial vector

Moreover, in biological transmission, the vector responsible for the transmission is also infected by the disease-causing pathogen. Generally, most arthropods that serve as vectors bite the host , producing a wound, which in turn facilitates the entry of the pathogen into the host. Moreover, the saliva of these arthropods contains infectious particles produced by the pathogen inside its gut. Thus, pathogens to be transmitted into the host spend a part of their reproductive life cycle inside the vector. Therefore, the vector serves as the intermediate host, and it transmits pathogens to the definitive host.

Furthermore, mosquitoes transmitting malaria, lice transmitting typhus, arachnids and ticks transmitting Lyme disease, mites transmitting scrub typhus, etc. are some examples of biological transmission of pathogens. Some mammals also serve as vectors by transmitting rabies to humans and chicken and other domestic poultry transmitting avian influenza to human.


How is NIAID addressing this critical topic?

NIAID conducts and supports a comprehensive vector biology research program to advance science and identify approaches that will help control or prevent the transmission of vector-borne pathogens to humans. This includes a variety of basic research projects that will contribute to a better understanding of key aspects of the biology of arthropod vectors. The program also supports translational and clinical research projects to identify and evaluate products and techniques designed to prevent the transmission of pathogens. These include the development of traps and repellents, the use of biologicals such as Wolbachia bacteria, and the evaluation of novel candidate vaccines based on mosquito saliva.


Ver el vídeo: La Covid19 ha demostrado que otros virus de origen animal pueden amenazarnos, cómo se previene? (Junio 2022).


Comentarios:

  1. Ghalib

    Aconsejo a todos que miren

  2. Vayle

    Creo que está equivocado. Estoy seguro. soy capaz de demostrarlo.

  3. Estcott

    No sé si es posible decirlo aquí y que



Escribe un mensaje